QUESTION 13 The phenomenon by which an allele containing a deletion in a tumor suppressor gene causes a good copy of the gene carried on the other allele to undergo deletion is an example of OA. Penetrance. OB. Chromatid dysjunction OC. Loss of heterozygosity OD. Allelic exclusion O E. Chromosomal translocation

Q: Question 2 2 pts Henrietta goes for her annual physical and receives the results of her blood tests.…

A: Introduction Hematocrit is a type of blood test which measures the percentage of RBC in the blood.…

Q: Which of the following is correct about feedback systems? O Positive feedback systems resist change…

A: Homeostasis refers to the process of maintaining internal physiological parameters in a changing…

Q: SUBJECT: GENETICS Topic: Binomial Probability Consider albinism a trait to occur in a human…

A: Probability that 2 offspring will be normal is 3/2. Probability that 1 offspring will be albino is…

Q: The West Nile virus has what mode of transmission? a) Propagative b) Cyclo-propagative c)…

A: Answer- propagative

Q: Discuss the role of phytohormones, fertilizers and pesticides, and genetic engineering in the…

A: Plant Growth and Development means need to  study the control and coordination processes takes place…

Q: Topic: Human Sex Anomalies Describe the following : a.1. XYY sex anomaly     a.2. Jacob’s syndrome…

A: The loss, damage, or inclusion of one or both sex chromosomes causes or affects a set of genetic…

Q: Please explain how an intermediate filament is similar and different in a normal skin cell while in…

A: Answer :- As we know that the intermediate filaments involve the significant part of the…

Q: SUBJECT: GENETICS HUMAN SEX CHROMOSOME Distinguish male from female human beings. (Based on sex…

A: Sexual reproduction refers to the form of reproduction that occurs through the union of male and…

Q: Supposing two strains of autotetraploid plants are available and their genotypes are as follows.…

A: Im answering only first part Answer :- We know that genotype contributes to phenotype. Genotype is…

Q: Which antibiotic would you want to take based on the results found in the table? I would take…

A: Zone Of Inhibition: A Zone of Inhibition Test, commonly known as a Kirby-Bauer Test, is a…

Q: To determine: The reason why most enzymes do not operate at their biochemical optima inside cells.

A: All enzymes share three characteristics. They are distinct in their specificity, regulatory ability,…

Q: Achondroplasia, which is characterized by difficulty converting cartilage to bone and thus results…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: To determine: The special properties that an enzyme isolated from a psychrophilic bacterium will…

A: Introduction Proteins that operate as biological catalysts are known as enzymes. Chemical reactions…

Q: 14- 13- 12- 11 10- 15 Co 나 16 17 18 19 20 21 -3 1 -2 -5

A:

Q: Create a list of two potential threats to biodiversity in your immediate area and describe their…

A: Introduction Biodiversity:- It is all the different kinds of life you'll find in one area, it is…

Q: Which of the following is not true of the lymphatic system? a. Oxygen is transported to body tissues…

A: Introduction The spleen, thymus, lymph, lymph nodes, and lymph vessels make up the lymphatic system.…

Q: A person has a blood pressure of 145/95. What does the number 145 represent? Select one: O a.…

A: ANSWER) (c) systolic pressure due to ventricles contracting. Systolic blood pressure is the pressure…

Q: Construct a restriction map for Plasmid X to show the recognition sites for two commonly used…

A: A restriction map is a representation of known restriction sites in a DNA sequence. Restriction…

Q: Finger pulse start of pulse upswing to peak (s) Total time (upswinging to baseline, s) 0.090 0.240

A: Introduction:- From the heart to the lungs, oxygen-rich blood is transported by the circulatory…

Q: Energy and cellular functions: The evolution of the Prokaryotic cell type into the Eukaryotic cell…

A: Chloroplasts are structure exclusive to the eukaryotic organisms. This was an important development…

Q: The following table indicates the blood plasma components of several patients. Urea Uric Acid…

A: Blood: Blood is a constantly circulating fluid that provides the body with nutrients, oxygen, and…

Q: A population of wolves in a national park is known to be 150 individuals. As wildlife ecologist, you…

A: Ecosystem balance, often known as "ecosystem homeostasis," is influenced by both factors that tend…

Q: Fill in the boxes with the appropriate words to complete the process of gas exchange within the…

A: a. capillary b. Oxygen c. Carbon di oxide d. alveoli e. Red Blood cells

Q: Remember for T/F questions, either answer TRUE or FALSE, but if the answer is FALSE make sure to…

A: Chaperonins are characterized by a stacked double-ring structure.

Q: I Ⅱ III IV V VI 2 3 1-5 1 ठ्ठ 7 6-9 10-12 13 14 2 2 T 7 8 3-5 2 ② 9-10 11 On 12 15 16-17 18 3-4 5-7…

A: Pedigree is a family chart showing the inheritance of a particular trait through several generations…

Q: Which is true for cancer cells:  1) Cell death occurs after a determined number of cell divisions…

A: Cancer are one of the main causes of death due to chronic failure of organs such as stomach, lungs…

Q: 19. Which of the following "range of phenotype" graphs best captures this story: a species of beetle…

A: The natural selection depends on the reproductive fitness of the individuals. Nature always select…

Q: 9. The water in warmer streams possess d. Feed the beans to the chickens, wait for the chickens to…

A: C. More ,less,more

Q: What are the optimal fermentation conditions for producing succinic acid, citric acid, and lactic…

A: Optimal fermentation conditions for acid production :-

Q: B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as…

A: ANSWERS Template -----> 5' GTAGCCTACCCATAGG 3' 1. Ans ) Complementary Strand ----->…

Q: To examine: Whether the given statement, "most of the DNA sequences in a bacterial genome code for…

A: Nucleic acids are genetic material that can be passed down through generations. Nucleic acids are…

Q: To determine: The special properties that an enzyme isolated from a psychrophilic bacterium will…

A: Enzymes are biocatalysts that aid in the acceleration of the reaction. They are proteins that help…

Q: A student was observing a filament of blue green bacteria under low power (60X). The diameter of the…

A: A. Average length of one cell = 2.4 mm/ 40=0.06 mm Under 60X = 40 cells, each is 0.06 mm in length

Q: current themes in depression

A: Depression Depression is defined as a state of mind where the mood is not happy. It causes a lack of…

Q: This Z diagram of the light dependent reaction shows how an electron moves from the reaction center…

A: The "Zscheme" describes the oxidation/reduction changes that occur during photosynthesis's light…

Q: Describe or draw the process of creating a vesicle from an ER membrane OR fusing a vesicle with the…

A: A vesicle is a tiny cell structure made up of fluid and a lipid bilayer. Exocytosis, phagocytosis,…

Q: A metabolic pathway can have unfavorable reactions within the pathway as long as the total sum of…

A: Introduction Metabolic pathway:- A metabolic pathway is a linked series of chemical reactions…

Q: Describe the significance of oxygen in the last phase of aerobic respiration using specific examples

A: In This question we have to describe about role of  oxygen  in aerobic respiration and aerobic…

Q: To determine: Whether ribosomal RNA genes were "born" perfect.

A: Ribosomes are complicated organelles that play a role in protein synthesis in all living cells. They…

Q: In venetian violets, three phenotypes occur with respect to flower color: a deep violet (almost…

A: 3 phenotypes present .  Deep violet/black  Pale lavender  White

Q: An individual presents with cardiac tamponade.  Their heart would be the most efficient in pumping…

A: cardiac tamponade is a medical condition where there is build up of fuilds in the pericardial sacs.…

Q: 160 155 the fungal counts obtained, will t ause the computed CFU/mL is 4.3 x ause the computed…

A: A colony forming unit, or CFU, is a measurement of the number of microorganisms present in a test…

Q: The principle that species cannot occupy the same niche forever, one will eventually exclude the…

A: Introduction A species' ecological niche is described as the role or position that it plays in its…

Q: Which animal do you think would have the longest intestine/longest digestive time? O A carnivore…

A: ANSWER;- An herbivore that eats only nutrient-poor leaves. Explain;-The small intestine system is…

Q: Which of the following is not a function of the lymph nodes? They supply lymphocytes for the body a.…

A: Introduction A lymph node is a small bean-shaped structure in the immune system of the body. Lymph…

Q: What role do feedback mechanisms play in the regulation of hormone production in mammals? Give two…

A: Regulation of hormone production The control of the production of hormones is vital for the process…

Q: Why sheep blood added in blood agar preparation does not coagulate prior to its use

A: Introduction:- Sheep blood agar is commonly used to describe haemolytic bacteria for identification…

Q: Survival of Species over Several Generations

A: Hybrid zone: an area where the ranges of two interbreeding species meet and interbreed Hybrid…

Q: Remember for T/F questions, either answer TRUE or FALSE, but if the answer is FALSE make sure to…

A: Rubisco stands for Ribulose Bisphosphate Carboxylase Oxygenase. It is the most abundant…

Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…

A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.