Replication Bubbles When all of the bubbles have collided, two new strands of DNA have been made. Having multiple replication bubbles, and therefore multiple sites of replication, increases the speed that DNA is copied. Instead of taking a month to replicate DNA, it takes only a couple of hours. Origin of Replication Replication Forks Replication Bubble 2 Replicated Strands of DNA 13. Multiple sites of replication allow cells to duplicate their DNA Topoisomerase and Helicase DNA replication is carried out by a series of enzymes all working together. Topoisomerase, one of these enzymes, is involved in unwinding the DNA strand. As replication occurs, the DNA strand becomes overly twisted and can snap. Topoisomerase cuts the strand of DNA, allowing it to untwist. Then it reattaches the DNA strands together where it was cut. Helicase, another enzyme, breaks the hydrogen bonds that hold bases together, allowing other enzymes to add complementary nucleotides. Single-Strand Binding Proteins (SSB's) keep the strands separated. Topoisomerase 14. unwinds DNA. Helicase 15. Helicase separates the nitrogenous bases by breaking the bonds. 16. SSB Proteins keep the two strands SSB Proteins

Replication Bubbles When all of the bubbles have collided, two new strands of DNA have been made. Having multiple replication bubbles, and therefore multiple sites of replication, increases the speed that DNA is copied. Instead of taking a month to replicate DNA, it takes only a couple of hours. Origin of Replication Replication Forks Replication Bubble 2 Replicated Strands of DNA 13. Multiple sites of replication allow cells to duplicate their DNA Topoisomerase and Helicase DNA replication is carried out by a series of enzymes all working together. Topoisomerase, one of these enzymes, is involved in unwinding the DNA strand. As replication occurs, the DNA strand becomes overly twisted and can snap. Topoisomerase cuts the strand of DNA, allowing it to untwist. Then it reattaches the DNA strands together where it was cut. Helicase, another enzyme, breaks the hydrogen bonds that hold bases together, allowing other enzymes to add complementary nucleotides. Single-Strand Binding Proteins (SSB's) keep the strands separated. Topoisomerase 14. unwinds DNA. Helicase 15. Helicase separates the nitrogenous bases by breaking the bonds. 16. SSB Proteins keep the two strands SSB Proteins

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
Human Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second in human cells and origins of replication occur every 300 kbp. Assume also that human DNA polymerases are highly processive and only two molecules of DNA polymerase arc needed per replication fork. How long would it take to replicate the entire diploid human genome? How many molecules of DNA polymerase does each cell need to carry out this task?
Which statements are true? Explain why or why not.1 The different cells in your body rarely havegenomes with the identical nucleotide sequence.2 In E. coli, where the replication fork travels at 500nucleotide pairs per second, the DNA ahead of the fork—in the absence of topoisomerase—would have to rotate atnearly 3000 revolutions per minute.3 In a replication bubble, the same parental DNAstrand serves as the template strand for leading-strandsynthesis in one replication fork and as the template forlagging-strand synthesis in the other fork.4 When bidirectional replication forks from adja-cent origins meet, a leading strand always runs into a lag-ging strand.5 DNA repair mechanisms all depend on the exis-tence of two copies of the genetic information, one in eachof the two homologous chromosomes
The proofreading function of DNA polymerase involves the recognitionof a ________ and the removal of a short segment of DNA in the __________ direction.a. missing base, 5′ to 3′b. base pair mismatch, 5′ to 3′c. missing base, 3′ to 5′d. base pair mismatch, 3′ to 5′
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG−OH Match the items in the left column to the appropriate blanks in the sentence on the right.
Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
Bacterial and eukaryotic replication, have many similarities. Which of the following is not a true comparison? Group of answer choices Both form loops with the lagging strand template to accommodate the antiparallel nature of DNA. Both incorporate a sliding clamp mechanism in their replication polymerase. Both initiate replication with recognition of conserved sequences, where the DNA will first open up (using proteins) Both have a primer made only of ribonucleotides, and then exhibit polymerase switching to the replicative polymerase.
Draw a replication bubble. Be sure to label the directionality of all strands of DNA. For one of the two replication forks, draw and label all of the proteins required the text describes as being important for DNA synthesis, and label the leading and lagging strands.
Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands ofnucleotides at a moving fork. How is this additionaccomplished?
5' ATTTACGTTTT 3' 3' TAAATGCAAAA 5' Need help drawing a diagram showing the replication fork at the beginning of the ORI that includes the leading strands, lagging strands, snd the Okazaki fragments of the ORI template
Polymerases usually add only about 10 nucleotides to a DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands of nucleotides at a moving fork. How is this addition accomplished?