Replication forks 3 5' A helicase "unzips" the two strands of DNA. Leading strand RNA primer Helicase DNA polymerase adds nucleotides onto the 3' end of the strand. 3 Synthesis of the leading strand proceeds continuously as fresh template is exposed. 5 Okazaki fragment of the lagging strand Primase synthesizes the RNA primer. Synthesis of the lagging strand must be reinitiated as more template is exposed. Each time synthesis is reinitiated, a new RNA primer must be made. Discontinuous synthesis generates Okazaki fragments. 3. 5 DNA ligase seals the gaps between Okazaki fragments by forming a covalent bond between them. As DNA polymerase adds nucleotides to the 3' end of one Okazaki fragment, it encounters the 5' end of another. A different type of DNA polymerase then removes the RNA primer nucleotides and simultaneously replaces them with deoxynucleotides. DNA ligase 3 FIGURE 7.7 The Replication Fork This dlagram is simplified to highlight the key differences between synthesis of the leading and lagging strands. Both strands are synthesized simultaneously. to in n

Replication forks 3 5' A helicase "unzips" the two strands of DNA. Leading strand RNA primer Helicase DNA polymerase adds nucleotides onto the 3' end of the strand. 3 Synthesis of the leading strand proceeds continuously as fresh template is exposed. 5 Okazaki fragment of the lagging strand Primase synthesizes the RNA primer. Synthesis of the lagging strand must be reinitiated as more template is exposed. Each time synthesis is reinitiated, a new RNA primer must be made. Discontinuous synthesis generates Okazaki fragments. 3. 5 DNA ligase seals the gaps between Okazaki fragments by forming a covalent bond between them. As DNA polymerase adds nucleotides to the 3' end of one Okazaki fragment, it encounters the 5' end of another. A different type of DNA polymerase then removes the RNA primer nucleotides and simultaneously replaces them with deoxynucleotides. DNA ligase 3 FIGURE 7.7 The Replication Fork This dlagram is simplified to highlight the key differences between synthesis of the leading and lagging strands. Both strands are synthesized simultaneously. to in n

Name: Synthesis of which strand requires the repeated action of DNA ligase?
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Synthesis of which strand requires the repeated action of DNA ligase? Replication forks35'A helicase "unzips"the two strands of DNA.LeadingstrandRNA primerHelicaseDNA polymerase addsnucleotides onto the 3'end of the strand.3Synthesis of the leading s

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands ofnucleotides at a moving fork. How is this additionaccomplished?
he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxysequencing experiment anneals just to the left of this sequence, drawthe sequencing ladder that will be obtained.
Review Figures 8.12 and 8.13. In cells, the primers for DNA synthesis are short strands of RNA, so each newly-synthesized strand of DNA has a segment of RNA al its 5 end. As replication proceeds, DNA polymerases remove these RNA segments and fill in the resulting gaps with DNA. However, the gaps at the very 5 ends of the new strands cannot be filled in with DNA. Why not? DNA replication leaves exposed about 100 nucleotides al the 5 end of each template strand, and these single-stranded ends are removed. What are the effects of this "end problem" on a cell's DNA as it continues to divide? FIGURE 8.12 DNA replication. Green arrows show the direction of synthesis for each strand. The Y-shaped structure where the DNA molecule is being unwound is called a replication fork. FIGURE 8.13 Discontinuous synthesis of DNA. This close-up of a replication fork shows that only one of the two new DNA strands is assembled continuously. The other is assembled in short segments.
Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.
List the differences and similarities in the way the twodaughter strands of DNA are synthesized at a replicationfork.
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Which end of the DNA template is 5′ and which end is 3′?
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
Polymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication process, DNA pol III can add tens of thousands of nucleotides at a moving fork. How this additionaccomplished?
Indicate the stage of DNA replication when each of thefollowing enzymes is active:a. helicaseb. primasec. DNA polymerasesd. ligasee. topoisomerasef. DNA gyrase
Assume that the sequence of bases shown below is presenton onenucleotide chain of a DNA duplex and that the chain has openedup at a replication fork. Synthesis of an RNA primer occurs on thistemplate starting at the base that is underlined.(a) If the RNA primer consists of eight nucleotides, what is itsbase sequence?(b) In the intact RNA primer, which nucleotide has a free 3'-OHterminus?3'.......GGCTACCTGGATTCA....5'