RNA polymerase contacts the promoter at specific sequences Promoter region Transcription start site -35 -10 5' AGTTAGTGTATTGACATGATAGAAGCACTCTACTATATTCT CA ATÁGGTCCACGG 3 AT A Mild effects GCA on transcription One-base deletion Two-base change Severe effects AT on transcription strands that had been shielded from the enzyme activity by the repressor mole- cule. These short strands presumably constituted the operator sequence. The base sequence of each strand was determined, and each operator mutation was shown to be a change in the sequence (Figure 11-12). These results showed that the operator locus is a specific sequence of 17 to 25 nucleotides situated just before (5' to) the structural Z gene. They also showed the incredible specificity of repressor-operator recognition, which can be disrupted by a single base substitu- tion. When the sequence of bases in the lac mRNA (transcribed from the lac operon) was determined, the first 21 bases on the 5' initiation end proved to be complementary to the operator sequence that Gilbert had determined, showing that the operator sequence is transcribed. The results of these experiments provided crucial confirmation of the mecha- nism of repressor action formulated by Jacob and Monod. FIGURE 11-11 Specific DNA sequences are important for the efficient transcription of E. coli genes by RNA polymerase. Only the non-template strand is shown here (see Figure 8-4). Transcription would proceed from left to right (5' to 3'), and the MRNA transcript would be homologous to the sequence shown. The boxed sequences are highly conserved in al E. coll promoters, an indication of their role as contact sites on the DNA for RNA polymerase binding, and contacts are made with both strands (not shown). Mutations in these regions have mild (gold) and severe (brown) affects on transcription. The mutations may be changes of single nucleotides or pairs of nucleotides, or a deletion (A) may occur. [Data from J. D. Watson, M. Gilman, J. Witkowski, and M. Zoller, Recombinant DNA, 2nd ed] 11.3 Catabolite Repression of the lac Operon: Positive Control