7 Identify the different regions of the mature mRNA by matching terms with regions.ВАAUGUGA5'сарЕxon 1 Exon 2 Exon 3 | Exon 4 AAАААAААААААААААААААААА 3'FE5'UTR3' UTRCoding sequenceВAPoly-A tailCEin

Name: 7 Identify the different regions of the mature mRNA by matching terms
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 7 Identify the different regions of the mature mRNA by matching terms with regions.ВАAUGUGA5'сарЕxon 1 Exon 2 Exon 3 | Exon 4 AAАААAААААААААААААААААА 3'FE5'UTR3' UTRCoding sequenceВAPoly-A tailCEin

Mature mRNA or mature transcript is the RNA present in eukaryotes which consists of exons with all…

Science

Biology

Identify the different regions of the mature mRNA by matching terms with regions. A В AUG UGA сар Exon 1 Exon 2 Exon 3 | Exon 4 АAAAААА АAAAAАААААААААА 3" F E 5'UTR F 3' UTR Coding sequence A Poly-A tail în

Identify the different regions of the mature mRNA by matching terms with regions. A В AUG UGA сар Exon 1 Exon 2 Exon 3 | Exon 4 АAAAААА АAAAAАААААААААА 3" F E 5'UTR F 3' UTR Coding sequence A Poly-A tail în

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 13P

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)
Translate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU -3'
Molecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA Hb A protein Hb S DNA 5’ GGC AGA CTT CTC CAC AGG AGT CAG GTG CAC 3’ Hb S mRNA Hb S protein transcribe and translate each sequence making the mRNA and protein sequence of each
Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG
The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?
Consider the following mRNA base sequence 5' CUU CAG 3 a What dipeptide is coded for this mRNA? b. What dipeptide is formed if a point mutation converts CUU to CUC? c. What dipeptide is formed it a point mutation converts CAG to AAG?
1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'
What would the sequence of the immature mRNA be? Place the sequence of ALL the transcript that would be synthesized from the gene. In each of the available line you should transcribe all nucleotides that form the immature mRNA. If the sequence indicated is not transcribed then write NA. WRITE THE NUCLEOTIDES IN CAPITAL LETTERS. Promoter: EXON 1: Intron 1: Exon 2: Intron 2: Exon 3 without terminator : Exon 3 terminator:
what does mature mRNA look like after processing? Include 5'cap, 5' UTR, +1 site, exons, 3' UTR, polyadenalation sequence, poly A tail.
The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. What would be the base sequence of the mRNA transcribed from this gene? Highlight the start codon sequence State the amino acid sequence of the polypeptide translated from this mRNA Based on the information from part (a) and (b), describe the process used by eukaryotes to produce protein.
5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’s