Given the following genomic sequence which contains 2 exons and CDNA sequence predict the amino acid sequence of the exons which are part of the coding region of a protein. How many nucleotides make up the intron? Second letter ... UAUTY UGU) UGCJ UAA Stop UGA Stop UAG Stop UGG Trp Phe UUC. UUA UCU UCC Ser UCA Cys UACJ UUG Leu UCG CUU CUC Leu CAU CACJ CGU CU CC CCA CCG His Pro CAAGN CGC Arg CGA CUA CAG GI AAUASA AACJ CGG AGUser AGC Ser CUG AUU AUC le ACC The AUA AUG Met ACG ACU) ACA The AAA Jys AAG J FLys AGG Arg GUU GCU GCC GCA GCG GAULASP GGC GGU GUC Val GUA Asp GAC Ala GAAGlu GGA Gly GGG GUG GAGJ Genomic antisense sequence: 5'-TAACTGATTCTAGGCTACTCTTTCACCTAA-3" CDNA sequence: 5'-TAACTGATTTCTTTCACCTAA-3' Use the editor to format your answer First letter Third letter

Q: From the picture provided, which colored option (exon variant) will give me: 1. start codon 2.…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: An mRNA transcript has the following complete sequence: 5'-AUGCCUACGUUACGGACC-3' Rewrite the…

A: Missense Mutation:  A missense mutation is a point mutation that results in a codon that codes for a…

Q: Based on your know | (hir sequence.

A: In many eukaryotic (and other prokaryotic) genes, the original RNA extracted from a genetic DNA…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Mutation is the sudden change in the base pair of sequence resulting in altered phenotype. The…

Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…

A: The knowledge included in the mRNA, which is created by replicating DNA, instructs the cell on the…

Q: . The human gene for ß2 lens crystallin has the components listed below. The numbers represent…

A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…

Q: eseg pL oseg sy non UCC UAU sko C. UAC UGA dos UGG UUA UCA UAA dois dois CGU ne UAG UCG dil CAU CUC…

A: Genetic code The combination of three nucleotides called codon . Each codon codes for an amino acid…

Q: The sequence below is a template strand sequence for a gene (a very short one!). Identify the start…

A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis of…

Q: 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: Transcription is the process of formation of RNA from a DNA. The RNA chain is synthesized in the…

Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: 3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is…

A: Codon  It is the three consecutive sequence of a mRNA that code for amino acid.

Q: An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon,…

A: In Amazon instant there are four type of nucleotide bases i.e adenine, guanine, cytosine and uracil.…

Q: If MRNA carries the code: UUU-UCG-ACU-GAU-GUU, then what is the corresponding code on the coding…

A: The mRNA or the messenger RNA is transcribed from the antisense or non-coding strand of the DNA as a…

Q: he question with gene sequence to predict amino acid sequence.

A: introduction  Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand…

A: DNA sequence is given. Top strand acts as template for mRNA synthesis. Top strand sequence is 3’…

Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Using the following coding DNA sequence:TAC GCA CCT TTA GAT CAT AAC TTT GGA ACT1. Write the…

A: Deoxyribose nucleic acid (DNA) is the genetic material composed of four nucleotide bases, namely…

Q: using the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: DNA is a double helical complex molecule which encodes all the information regarding an organism. It…

Q: 8. The following diagram illustrates a step in the process of translation. fMet Pro mRNA UAC GGG…

A: To identify the locations within the ribosome during protein synthesis (translation) corresponding…

Q: For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’…

A: 4 codes are used by the DNA that areAdenine (A), Thymine (T),  Guanine (G), Cytosine (C)RNA also…

Q: The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using…

A: Introduction  Gene expression is the process through which a gene's information is utilised in the…

Q: if the following DNA sequence were transcribed, which of the following describes the output of this…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: 5' AGGGUUUGGGAUGAAUCGACGACGAUCCUACGUACUAAGUA 3' Write the amino acid sequence for this portion of…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: The following DNA sequence corresponds to the two extreme ends of a gene's coding region: 5'…

A: Introduction = The genetic code consists of tripletsThe group of three nucleotides that together…

Q: Translate the following mRNA: 5-A U G A A A U U U C U U U A G G U C G A A -3     NH3+-…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Determine each of the following items using the hnRNA nucleotide sequence (enter the answer using…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Refer to the genetic code in Figure 15.10 to answer the following question Q. If a single…

A: Proteins are the translational products of the genetic information encoded in the nucleotide series…

Q: Where would you find the base pairs that constitute the promoter? h. Which intron interrupts the 3′…

A: Base pairs that constitute the promoter are located at the 5' end of the UTR region. Promoter are…

Q: Consider the following gene with their respective introns and exons   5’ –…

A: Since you have asked multiple questions, we will solve the first three question for you. If you want…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA…

A: Translation is the process of synthesis of protein from mRNA . So , RNA serves as a template . But ,…

Q: The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase…

A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: Your labmate gives you a gene with the following sequence of the coding strand for the first 5 amino…

A: given DNA strand first form the complimentary starnd by changing A - T and G-C for the strand 3' to…

Q: ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in…

A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

Q: Second letter A G UUU Phenyl- UUC alanine UAU UAC UGU UGC Oysteine UCU Tyrosine UCC Serine UUA UUG…

A: The genetic codon present in the mRNA will be translated during the translation process by ribosome…

Q: An anticodon of tRNA has the sequence GCA. What amino acid does this tRNA carry? HINT: you use mRNA…

A: Codons are in the form of triplets , for example AUG that codes for methionine ( amino acid). Codons…

Q: Given the following DNA sequence from the template strand of a given gene:…

A: Codon is a  sequence of three nucleotides which together form a unit of genetic code in a DNA or RNA…

Q: The figure below shows a ribosome in the process of translating an mRNA with a sequence:…

A: Translation is a process in which a single stranded RNA sequence formed at the end of transcription…

Q: Using the table of genetic code, choose the CORRECT protein sequence that will be produced from the…

A: Genetic code is a triplet code called a codon. There are 64 codon out of which three codon do not…

Q: Which of these molecules has multiple partial charges and thus is most soluble in water? H H HHHH…

A: Most soluble in water.

Q: Translate the protein that is expressed from this template DNA sequence. Transcription is going left…

A: Transcription is the process of formation of mRNA from a DNA transcript. It occurs ont he template…

Q: Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA Which…

A: According to the central dogma of life, DNA replicates to form copies of itself. DNA acts as a…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.