The consensus sequence of the protospacer adjacent motif (PAM) sequence in bacterial strain A is 5'-NGG-3, whereas in bacterial strain B the consensus PAM sequence is 5'-NGRRN-3. Calculate the frequency at which each of these PAM sequences will occur in DNA using N- any nucleotide and R purine base. Bacterial strain A: PAM sequence occurs once in every 16 nucleotides Bacterial strain B: PAM sequence occurs once in every 32 nucleotides Bacterial strain A: PAM sequence occurs once in every 32 nucleotides Bacterial strain B: PAM sequence occurs once in every 16 nucleotides Bacterial strain A: PAM sequence occurs once in every 32 nucleotides Bacterial strain B: PAM sequence occurs once in every 32 nucleotides Bacterial strain A: PAM sequence occurs once in every 16 nucleotides Bacterial strain B: PAM sequence occurs once in every 16 nucleotides

The consensus sequence of the protospacer adjacent motif (PAM) sequence in bacterial strain A is 5'-NGG-3, whereas in bacterial strain B the consensus PAM sequence is 5'-NGRRN-3. Calculate the frequency at which each of these PAM sequences will occur in DNA using N- any nucleotide and R purine base. Bacterial strain A: PAM sequence occurs once in every 16 nucleotides Bacterial strain B: PAM sequence occurs once in every 32 nucleotides Bacterial strain A: PAM sequence occurs once in every 32 nucleotides Bacterial strain B: PAM sequence occurs once in every 16 nucleotides Bacterial strain A: PAM sequence occurs once in every 32 nucleotides Bacterial strain B: PAM sequence occurs once in every 32 nucleotides Bacterial strain A: PAM sequence occurs once in every 16 nucleotides Bacterial strain B: PAM sequence occurs once in every 16 nucleotides

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Assume that a DNA sequencing reaction is carried out, except that the four different dideoxyribonucleoside triphosphates are modified so that each contains a covalently attached dye of a different color (which does not interfere with its incorporation into the DNA chain). What would the products be if you added a mixture of all four of these labeled dideoxyribonucleoside triphosphates along with the four unlabeled deoxyribonucleoside triphosphates into a single sequencing reaction? What would the results look like if you electrophoresed these products in a single lane of a gel?
please list all possible products in a sequencing reaction using ddGTPA as a terminator based on the following sequences of a template : 3'-GGGCTATACCTGACCCTC-5'
• Kornberg and his colleagues incubated soluble extracts of E. coli with a mixture of dATP, dTTP, dGTP, and dCTP, all labeled with 32P in the α-phosphate group. After a time, the incubation mixture was treated with trichloroacetic acid, which precipitates the DNA but not the nucleotide precursors. The precipitate was collected, and the extent of precursor incorporation into DNA was determined from the amount of radioactivity present in the precipitate.a. If any one of the four nucleotide precursors were omitted from the incubation mixture, would radioactivity be found in the precipitate? Explain.b. Would 32P be incorporated into the DNA if only dTTP were labeled? Explain.c. Would radioactivity be found in the precipitate if 32P labeled the or phosphate rather than the phosphate of the deoxyribonucleotides? Explain.
The chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?
The principal genomic component isolated from equine influenza virus is 22% C, 23% A, 22% G and 33% U. Is this sufficient data to determine whether the genomic material is DNA/RNA and is double- or single-stranded? Why or why not? Explain, using a diagram
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
Please list all possible products in a sequencing reaction using ddGTP as a terminator based on the following sequence of a template. 3’ – GGGCTATACCTGACCCTC – 5’
The E. coli genome contains 1009 Chi sequences. Do these sequences occur at random, and, if not, how much more or less frequently than random do they occur?
Calculate the expected number of times that a given 8-base-pair DNA site should be present in the E. coli genome. Assume that all four bases are equally probable. Repeat for a 10-base-pair site and a 12-basepair site
The human genome contains approximately 106 copies of an Alusequence, one of the best-studied classes of short interspersedelements (SINEs), per haploid genome. Individual Alus share a282-nucleotide consensus sequence followed by a 3'-adeninerichtail region. Given that there are approximately 3 * 109bp per human haploid genome, about how many base pairs arespaced between each Alu sequence?
Calculate the length of the DNA of bacteriophage lambda that has 48502 base pairs.
A plasmid vector pBS281 is cleaved by the enzymeBamHI (5′ G^GATCC 3′), which recognizes only onesite in the DNA molecule. Human DNA is digestedwith the enzyme MboI (5′ ^GATC 3′), which recognizes many sites in human DNA. These two digestedDNAs are now ligated together. Consider only thosemolecules in which the pBS281 DNA has been joinedwith a fragment of human DNA. Answer the following questions concerning the junction between thetwo different kinds of DNA. a. What proportion of the junctions between pBS281and all possible human DNA fragments can becleaved with MboI?b. What proportion of the junctions between pBS281and all possible human DNA fragments can becleaved with BamHI?c. What proportion of the junctions between pBS281and all possible human DNA fragments can becleaved with XorII (5′ C^GATCG 3′)?d. What proportion of the junctions between pBS281and all possible human DNA fragments can becleaved with BstYI (5′ R^GATCY 3′)? (R and Ystand for purine and pyrimidine, respectively.)e.…