For the following five sequences, what is the consensus sequence? 5′–GGGAGCG–3′ 5′–GAGAGCG–3′ 5′–GAGTGCG–3′ 5′–GAGAACG–3′ 5′–GAGAGCA–3′ a. 5′–GGGAGCG–3′ b. 5′–GAGAGCG–3′ c. 5′–GAGTGCG–3′ d. 5′–GAGAACG–3′
Q: If you set up an in vitro translation reaction containing poly(ACGU), as template, which of the…
A: A three-letter codon is a sequence of DNA or RNA that corresponds to a specific amino acid. These…
Q: Using the genetic code, indicate which polypeptides would be synthesized if poly-UGG were used in a…
A: Polypeptides are the linera chain of Amino acids Synthesised according to the codons on mRNA.…
Q: You would like to use a CRISPR-Cas system to knockout a gene that includes the following sequence:…
A: CRISPR (Clustered regularly interspaced short palindromic repeats)-Cas is a gene-editing tool. It…
Q: Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different…
A: Fredrick Sanger developed a method that is referred to as chain termination and dideoxy sequencing.…
Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…
A: The central dogma of life can be stated as follows: Replication of DNA to form new copies of DNA…
Q: Which of the following would restore a gene back to its proper reading frame? A. one insertion that…
A: A frameshift mutation is a genetic mutation caused by the insertion of deletion of a number of…
Q: Complete the tables below to determine the polypeptide chain of a functional and mutated hemoglobin…
A: 1st Six Codons of the Functional Hemoglobin Gene... DNA.. GTG CAC CTG ACT CCT GAG mRNA codon is ..…
Q: The template strand of wild-type gene A is shown below. On the space provided, type the translation…
A: Amino acids are known as the building blocks of protein. They are required for the synthesis of…
Q: The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3'…
A: Transcription is the process by which the information in a strand of DNA is copied into a messenger…
Q: If a point substitution mutation changes the sequence 5'ATGAAA3' to 5'ACGAAA3' in the MIDDLE of the…
A: Point mutation is a genetic mutation in which a single nucleotide base is altered, inserted or…
Q: What is a reasonable length for an RNA primer in E.coli? A. 1000 nucleotides B. 100…
A: In DNA replication one strand of DNA which is lagging require RNA primer to start the synthesis of…
Q: 5' guanine cap 5' AUGCCGAUGCCUCCUAUCAGAUAAAAUAAA poly A tail AAAA 3' During DNA replication, a…
A: The mutation is the sudden and abrupt change in the structure and function of the chromosomes.
Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…
A:
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…
A: According to guidelines we have to answer the first 3 sub-parts only. so please kingly post the…
Q: Complete the DNA and RNA sequencing for the translation and creation of proteins. 1. DNA 3' CCC…
A: The genomic structure of an organism consists of DNA which contains sugar molecule, phosphate group,…
Q: Which of the following pairs of sequences might be found at the ends of an insertion sequence? a.…
A: Insertion sequence (IS) is defined as a short sequence of DNA acting as a transposon (jumping gene…
Q: he question with gene sequence to predict amino acid sequence.
A: introduction Translation is the process of translating the sequence of a messenger RNA (mRNA)…
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Posttranscriptional modifications include adding a 5’ cap and a 3’ tail removing a 5’ cap and a 3’…
A: The process by which the information contained in a strand of DNA is transcribed into a new molecule…
Q: mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide…
A: DNA is the store house of genetic information, DNA is transcribed into mRNA through the process of…
Q: For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also…
A: Option 1 i.e. 5' AUA 3' is the correct answer.
Q: Please list all possible products in a sequencing reaction using ddGTP as a terminator based on the…
A: 1.As dd GTP is used, every time it encounters C base it will terminate. 2.When C is encountered with…
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…
A: According to guidelines we have to answer the first 3 sub-parts only. so please kingly post the…
Q: Below is a small stretch of DNA in the middle of a gene. What amino acid sequence would be encoded…
A: Amino acids are the organic compounds that contain amino group and carboxyl group functional groups…
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…
A: According to guidelines we have to answer the first 3 sub-parts only. so please kingly post the…
Q: Dideoxysequencing relies on which one of the following choices: A):Random stopping of one of many…
A: Introduction :- Dideoxysequencing is used in sanger sequencing. Sanger sequencing is a DNA…
Q: For each of the following sequences, place a check mark in the appropriate space to indicate the…
A: DNA replication is the process by which a single DNA strand will produce two identical daughter…
Q: Which sequence is most likely to be found in a promoter? a) CGGTGTATATCGTAC b) GTACAGTCATCCCGT c)…
A: Promoter It is a DNA sequence that controls whether a gene is turned on or off. The promoter…
Q: Given this sequence: AUG TAT ACC GAG, which of the following would result in a frameshift mutation?…
A: The sudden, inheritable, and stable alteration in the genetic material is said to be a MUTATION. The…
Q: Let’s suppose a researcher mixed together nucleotides with the following percentage of bases: 30% G,…
A: DNA full form is deoxyribonucleic acid. DNA is the main constituent of the chromosome. It contains…
Q: Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different…
A: In manual Sanger sequencing, four PCR reaction are set up, each with only a single type of ddNTP…
Q: Part of the protein-coding region in a gene has the base sequence 3-…
A: Gene Gene is the part of DNA which code for polypeptide chain.
Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…
A: DNA stands fo deoxyribonucleic acid. It is the genetic material.
Q: ) Assuming that transcription starts with the first C in the template strand, and continues to the…
A: Transcription Transcription is the process in which the template strand of DNA is copied into mRNA…
Q: Which of the following best describes this type of mutation? Original – CCU-GAU-GAG-UCA…
A: Introduction : Mutations are modifications to the genetic sequence. Mutations can involve the…
Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…
A: Mutations in the DNA molecule are caused by a spontaneous alteration. After a synonym mutation, the…
Q: For each of the following sequences, place a check mark in the appropriate space to indicate the…
A: DNA replication is the process of generating two identical copies from the original DNA strand. The…
Q: You see partial sequence of a gene as follows (non template strand shown)…
A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…
Q: What is the function of the Shine–Dalgarno consensus sequence?
A: Prokaryotes are the organisms that lack the cell nucleus and membrane-bound organelles. They have…
Q: - Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…
A: mRNA contains coding regions (exons) and non-coding regions (introns). The introns are removed by…
Q: An ORF 1,200 bp in length can encode a protein of what size?
A: Proteins Proteins are the building block of our body they are synthesized by the process of…
Q: plz explain with thorough explanation
A: Introduction : The physical appearance of an organism such as colour, height, which occurs as a…
Q: The template strand of a gene has the sequence 5'-ATGCCTAGCCTAGGACT-3', What will the sequence of…
A: Here, the question is asking about mRNA transcript whose synthesis takes place in 5'-3' direction…
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…
A: According to guidelines we have to answer the first 3 sub-parts only. so please kingly post the…
Q: In the table below, there are four versions of gene A, one of which is normal, and the other three…
A: Mutations are sudden heritable changes that change gene expression. These changes in gene expression…
Q: Which of the following mutations would have the greatest negative impact on the protein product of a…
A: Mutations are studied to understand the genetic mechanism behind the development of the disease.…
Q: Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different…
A: This method makes use of the mechanism of DNA synthesis by DNA polymerase DNA polymerase requires…
Q: A small section of bacterial DNA template (anti-sense) strand has the following nucleotide sequence:…
A: Frame shift mutation/Gibberish mutation It is a genetic mutation caused by loss or addition of one…
Q: In studying the mechanism of a particular enzyme, for which the cloned gene is available, you wish…
A: Site-directed mutagenesis is the molecular biology technique that alters the sequence of the target…
Q: Given Sequence:
A: The genetic information stored in a cell is transcribed into a messenger RNA by the process of…
For the following five sequences, what is the consensus sequence?
5′–GGGAGCG–3′ 5′–GAGAGCG–3′ 5′–GAGTGCG–3′ 5′–GAGAACG–3′ 5′–GAGAGCA–3′
a. 5′–GGGAGCG–3′
b. 5′–GAGAGCG–3′
c. 5′–GAGTGCG–3′
d. 5′–GAGAACG–3′
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which of the following pairs of sequences might be found at the ends of an insertion sequence? a. 5′–GGGCCAATT–3′ and 5′–CCCGGTTAA–3′ b. 5′–AAACCCTTT–3′ and 5′–AAAGGGTTT–3′ c. 5′–TTTCGAC–3′ and 5′–CAGCTTT–3′ d. 5′–ACGTACG–3′ and 5′–CGTACGT–3′ e. 5′–GCCCCAT–3′ and 5′–GCCCAT–3′What is the consensus sequence of the following six DNA sequences?GGCATTGACTGCCATTGTCACGCATAGTCAGGAAATGGGAGGCTTTGTCAGGCATAGTCAConsider this sequence below: GAG TAC ACG AGT GGA Which of the following options is an example of a non-synonymous point mutation? (remember to translate to mRNA!) A. GAG TAC AAT CGA GTG GA B. GAG TAC ACG GGT GGA C. GAG TAC A–G AGT GGA D. GAG TAC ACG AGA GGA
- In chain termination sequencing, which of the following terminates the chain? a. The lack of a base at the 1' carbon b. The lack of OH at the 2' carbon c. The lack of OH at the 3' carbon d. The lack of phosphate at the 5' carbonProvide the consensus sequence for the first three actual sequences shown in FigureThe sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.
- The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3' Which of these sequences corresponds to the mRNA after transcription A)5'-AUGAUAGUACUCUCUAUCCUC-3' B) 5'-TACTATCATGAGAGATAGGAG-3' c) 5'-ATGATAGTACTCTCTATCCTC-3' d) 5'-UACUAUCAUGAGAGAUAGGAG-3' E) N-Tyr-Tyr-His-Glu-Thr-CA small section of bacterial DNA template (anti-sense) strand has the following nucleotide sequence: AAG TAT TAT GCA A mutation in the above sequence involved the insertion of a single base, leading to a shift in the reading frame of the gene, resulting in altered amino acids downstream from the insertion. Which of the following gene sequences exemplifies the mutation described above? a. AAG CTA TTA TGC A b. AG TAT TAT GCA c. AAG TATU TAT GCA d. AAG TAT TAGT GCAPosttranscriptional modifications include adding a 5’ cap and a 3’ tail removing a 5’ cap and a 3’ tail removing of exons addition of exons
- Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-TyrWhat is the consensus sequence of these three DNA sequences? 5' - G G T G C A C - 3'5' - A A T T C A C - 3'5' - G G T T C T C - 3'For each of the following sequences, place a check mark in the appropriate space to indicate the process most immediately affected by deleting the sequence. Choose only one process for each sequence (i.e., one check mark per sequence). Process most immediately affected by deletion Sequence deleted Replication Transcription RNA processing Translation a. ori site _____ _____ _____ _____ b. 3′ splice site consensus _____ _____ _____ _____ c. Poly(A) tail _____ _____ _____ _____ d. Terminator _____ _____ _____ _____ e. Start codon _____ _____ _____ _____ f. -10 consensus _____ _____ _____ _____ g. Shine–Dalgarno _____ _____ _____ _____