The process by which the genetic code of DNA is copied into a strand of RNA is called O translation O transcription O transformation O replication
Q: The formation of mRNA from DNA is called translation. transcription.…
A: Question - The formation of mRNA from DNA is called A.) translation. B.)…
Q: If you remove the terminator from a gene, how will this disrupt the function of RNA polymerase?…
A: Transcription is the process of conversion of all the information from the DNA into mRNA in the cell…
Q: Gene expression includes which two of the following processes? O A. transcription and replication B.…
A: Gene expression:- This is a process where the gene’s genetic codes are used in managing the proteins…
Q: AC CAG CCC AAG ATT ____________ Transcription: Translation:
A: The flow of genetic information in a biological system is explained by central dogma and it involves…
Q: Which of these is a post-translational modification that targets a protein to the proteasome? LO…
A: Post-translational modifications include changes in the polypeptide chain after its synthesis during…
Q: Which component is not directly involved in translation?(A) GTP(B) DNA(C) tRNA(D) ribosomes
A: Translation is the process by which polypeptides are synthesized from a mRNA transcript, which was…
Q: The change in a single amino acid in protein result in Mutation O Genetic Code O Polymerization O…
A: Change in Single amino acid in a protein can change the protein structure and function.
Q: Match the process to the related enzyme/structure in Bacteria. translation [ Choose ] [Choose ] DNA…
A: There are several molecular processes that take place inside the cell. These processes are necessary…
Q: Contains deoxyribose instead of ribose. O messenger RNA O DNA O transfer RNA
A: Nucleic acids contain the genetic information needed for functioning of cell. These are of two types…
Q: Replication of DNA begins at and transcription of RNA begins at
A: In DNA replication the double-stranded molecule of DNA is copied for making two identical DNA…
Q: State one role for each of the following molecules in the process of protein synthesis. DNA: MRNA:…
A: Proteins are complex macromolecules that are involved in different body functions. They are produced…
Q: Which of the following statements is false of ligase? Ligase is specific to leading strand…
A: DNA ligase is a specific type of enzyme, that facilitates the joining of DNA strands together by…
Q: Which of the following processes is a part of protein synthesis and is NOT affected by a silent…
A: Introduction DNA is a self replicating molecule. During DNA replication each strand of DNA acts as a…
Q: Transcription produces O proteins from RNA. O proteins from DNA. DNA from RNA. O RNA from DNA.
A: Note- According to the guidelines, We are supposed to answer only 1st question. Please repost other…
Q: During transcription, an mRNA molecule is formed: *( Choose True if the statement is correct abourt…
A: Transcription: The process of making of mRNA from DNA carried out by an enzyme RNA polymerase.…
Q: n the process of transcription, the input is and the output is O tRNA, DNA O MRNA, protein O DNA,…
A: the central dogma of molecular biology suggest that biological information flows from DNA to RNA to…
Q: The molecule that carries the genetic information of DNA fromthe nucleus to the cytoplasm to be used…
A: Ribonucleic corrosive (RNA) is an extra-atomic hereditary material that lies in the cytoplasm.…
Q: How does a DNA molecule produce copies of itself? O replication O expression O translation O…
A: The production of new DNA from old DNA is known as replication process. The DNA replication occurs…
Q: This process is responsible for the formation of a new DNA helix.a. DNA replicationb.…
A: DNA is the genetic material of almost all living organisms. It contains genetic information which is…
Q: Which of the following is true about transcription? O transcription begins at a start codon and ends…
A: Transcription is the process of making RNA from the template strand of DNA. It takes place in the…
Q: Part A Which of the following processes is represented in the figure below? 3' AAG UGA RF1 RF2 O…
A: Thank you for the question Answer :- The given picture shows translation termination Explanation :-…
Q: Which strand of DNA is used by RNA polymerase during transcription? O Coding strand O Lagging strand…
A: The process of transcribing a piece of DNA into RNA is known as transcription. Messenger RNA is made…
Q: The term translation refers to which of the following? a. DNA → RNA b. RNA → DNA c. proteins → RNA…
A: DNA is the double-helical structure, which carries all the genetic information of the cell, whereas…
Q: What name is given to the assembly of proteins that carry out DNA copying at a replication fork? O…
A: Every time cells divide, eukaryotic genomes are duplicated with near-perfect fidelity. The…
Q: What name is given to the assembly of proteins that carry out DNA copying at a replication fork?…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Which process is illustrated in the diagram below? NNNNNNNNNNI Oa replication Ob.RNA processing Oc…
A: DNA synthesis inside the cell occurs when the cell decides to divide. DNA synthesis is carried out…
Q: What process occurs before the other? Transcription and then lonization Translation and then…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: During which process is MRNA synthesized from a DNA template with the aid of RNA polymerase? O…
A: Introduction Genome is referred to the total amount of DNA a single haploid cell contains. Genome…
Q: The most energy-intensive process (i.e. requires the most energy) in a cell is lipid catabolism.…
A: Our body requires energy to do any kind of work. This energy is present in the form of energy…
Q: Strong stop DNA forms during the first step of: RNA transcription O Reverse transcription O RNA…
A: Introduction: Reverse transcription is the process of synthesis of DNA from RNA using the enzyme…
Q: All of the following will move from the inside of the nucleus to the cytoplasm through a nuclear…
A: Nuclear pore complex allows the transport of molecules across the nuclear envelope. This transport…
Q: Ribosome is where the Process of translation takes place Process of moving DNA to the cytoplasm…
A: Ribosomes are made up of both proteins and RNA. These are a part of translational machinery present…
Q: Specific amino acids attached to molecules of tRNA, while antocodons align with codons of mRNA…
A: Replication, transcription, translation forms the central dogma of biology. It gives us an idea of…
Q: Which of the following molecules is (are) produced by translation? N A. RNA polymerase B. The…
A: The translation is a process of synthesis of proteins from the messenger RNA (mRNA). It is achieved…
Q: What is translation and transcription
A: Central dogma: a. The biological information passes from DNA to RNA and then to protein. b. It is…
Q: Which of the following processes includes the removal of introns in the primary RNA transcripts? O…
A: Introns are noncoding sequences of an RNA transcript or the DNA encoding it. In simple terms,…
Q: Any change in the sequence of DNA is called as O 1. transcription O 2. mitosis 3. mutation 4.…
A: well, any change in the sequence of DNA is called mutation. But for a much clearer concept, i would…
Q: The transformation process of messages carried by mRNA into amino acid sequences is called O DNA…
A: The genetic information encoded in the DNA must be transmitted from one generation to the next in…
Q: Which of the following molecules is used to transfer the genetic code from the nucleus to the…
A: Proteins are large biomolecules that play a significant role in the physiological activities of the…
Q: What is the function of DNA ligase? put DNA together are involved in transcription break down DNA O…
A: DNA ligase then enzyme which is used to catalyse and activate the formation of phosphodiester bonds…
Q: Transcription is..... dependent..... synthesis.
A: DNA/RNA
Q: Messenger RNA is formed by ________ of a gene on the DNAtemplate strand.a. transcription b.…
A: A gene is the essential physical and the functional unit of heredity. Genes are made up of DNA…
Q: The process of translation produces protein RNA sugar DNA none of these
A: Cells have many molecules present in the cytoplasm and organelles.
Q: Match each process with its product._____ transcription a. DNA_____ replication b.…
A: Central dogma explains the flow of genetic information. It states that information flows from DNA to…
Q: of the following determines the amino acid sequence of the protein produced during the process of…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…
Q: The process of ______ copies DNA, ______ makes an RNA molecule from a DNA template, and ______…
A: Replication is the process by which a double stranded DNA molecule is copied to produce two…
Q: The product of transcription is a polypeptide. a short piece of RNA. a short piece of DNA. a…
A: The central dogma of biology explains the flow of information from genes to protein by two…
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- List the differences and similarities in the way the twodaughter strands of DNA are synthesized at a replicationfork.DNA replication ATGGATCAGHTCCAGGGTACCCA what would the new strand look likeIndicate the stage of DNA replication when each of thefollowing enzymes is active:a. helicaseb. primasec. DNA polymerasesd. ligasee. topoisomerasef. DNA gyrase
- In the Meselson–Stahl experiment thatestablished the semiconservative nature of DNA replication,the extraction method produced short fragments of DNA. Whatsort of results might have been obtained with longer piecesof DNA?he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
- Plssss helppppp. Describe the purpose of DNA replication. What is it and why is it important?Which of the following statements about DNA replication is INCORRECT? It is powered bythe hydrolysis of ATP. Each strand withinthe DNA double helix is used as a template for synthesis of a new strand. It requires that both strands of the double helix be separated from each other. It proceeds withthe addition of new nucleotides to the 3′ end of a growing DNA strand. It begins atmultiple origins of replication sites along eukaryotic chromosomes.a. Do any strands of nucleic acid exist in nature inwhich part of the strand is DNA and part is RNA?If so, describe when such strands of nucleic acidare synthesized. Is the RNA component at the 5′end or at the 3′ end?b. RNA primers in Okazaki fragments are usually veryshort, less than 10 nucleotides and sometimes asshort at 2 nucleotides in length. What does this facttell you about the processivity of the primaseenzyme—that is, the relative ability of the enzymeto continue polymerization as opposed to dissociatingfrom the template and from the molecule beingsynthesized? Which enzyme is likely to have a greaterprocessivity, primase or DNA polymerase III?
- When DNA is replicated, two new DNA double helices areformed, each consisting of one parental strand and onenew, daughter strand. For this reason, DNA replication iscalled________ .Write out the resulting DNA molecules after the following double stranded DNA molecule is digested with EcoRI: 5’-ATGTTAGAATTCTACGTCGAATTCAAATTT-3’ 3’-TACAATCTTAAGATGCAGCTTAAGTTTAAA-5’(e) What difference would it make to bidirectional DNA replication if both modes of chain extension were equally favourable?