This is a paper centrifuge: (you don't need to watch the whole video, just a few seconds to see how it works--description below is probably sufficient if you can't get to the link) https://www.youtube.com/watch?v=isMYGtCFljc It is a paper disc that has supercoiled strings through two holes in the centre--like a button. As you straighten the strings and uncoil them, the paper spins. The paper spins at a very high rate and can separate materials in a way that is similar to a centrifuge. A droplet is added to the centre of the paper and it is spun. The densest objects travel the farthest from the centre. Assume that we are using it to perform our mitochondrial extraction, which cellular component would travel the furthest? nuclei mitochondria microvessicles blood cells

This is a paper centrifuge: (you don't need to watch the whole video, just a few seconds to see how it works--description below is probably sufficient if you can't get to the link) https://www.youtube.com/watch?v=isMYGtCFljc It is a paper disc that has supercoiled strings through two holes in the centre--like a button. As you straighten the strings and uncoil them, the paper spins. The paper spins at a very high rate and can separate materials in a way that is similar to a centrifuge. A droplet is added to the centre of the paper and it is spun. The densest objects travel the farthest from the centre. Assume that we are using it to perform our mitochondrial extraction, which cellular component would travel the furthest? nuclei mitochondria microvessicles blood cells

Biomedical Instrumentation Systems

1st Edition

ISBN:9781133478294

Author:Chatterjee

Publisher:Chatterjee

Chapter5: Biomedical Electronics: Digital

Section: Chapter Questions

Problem 3P

See similar textbooks

Similar questions

What are the advantages and disadvantages of using indented and bracket type dichotomous key? What are some key points, based on your work, in constructing a dichotomous key?
In not more than 200 words, explain how the human genome of 3.4 Gb would be in 2.3 meters long when stretched linearly if this size is fit into a cell of minuscule proportions.
Draw the following trinucleotide: pGAU
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?
Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer 5'GCCTCCGGAGACCCATTGG 3' Reverse primer 5'TTCTAAGAAACTGTTAAGG 3' (b) Forward primer 5'GGGGCCCCTCACTCGGGGCCCC 3'Reverse primer 5'TCGGCGGCCGTGGCCGAGGCAG 3' (c) Forward primer 5'TCGAATTGCCAATGAAGGTCCG 3'Reverse primer 5'CGGACCTTCATTGGCAATTCGA 3'
The following diagram represents one of the Christmas-tree-like structures shown in Figure On the diagram, identify parts a through i. Q. Possible location of a terminator
What is the meaning of the statement “The code is redundant but not ambiguous?”.
Convert the following sequence into protein strand using one letter code: 5'-ACCAACCAACTTTCGATCTCTTGTAGATCT-3'
For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'
I know I need to plot a Lineweaver-Burk plot, but the manual way I'm trying doesn't make sense. I'm seeing elsewhere that the x-intercept is 0.8 and the slope is 0.32 but I have no idea how those are being found. Could I get a step by step walkthrough of how I plot this in order to get the line equation? Or is there a way to plot it on a graphing calculator?
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________
3.5 INSTRUCTIONS — Do not copy in Google or Bartleby. Plagarize Checker will be used