A) The product is an RNA molecule whose sequence is identical to the template strand (except U for T). B) While RNA polymerase reads the template strand from 3' to 5', the RNA product is synthesized from 5' to 3'. C) The product is an RNA molecule whose sequence is complementary to the template strand. D) The product is an RNA molecule whose sequence is complementary to the non-template strand

A) The product is an RNA molecule whose sequence is identical to the template strand (except U for T). B) While RNA polymerase reads the template strand from 3' to 5', the RNA product is synthesized from 5' to 3'. C) The product is an RNA molecule whose sequence is complementary to the template strand. D) The product is an RNA molecule whose sequence is complementary to the non-template strand

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 22CTQ: If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to...

See similar textbooks

Similar questions

1. What is the production of RNA called and what is the enzyme that catalyzes the process?2. What are the similarities and differences between the transcription process and the repli-cation processes?3. Concerning their biological function what is the difference between DNA and RNA?4. Is there any situation in which DNA is made based on a RNA template? If there is,explain with an example how it occurs and state the enzyme involved?5. What is the difference between plasma membrane and cell wall?
1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.
Discuss how degeneracy of the genetic code makes cells more robust to mutations.
Discuss Concepts A mutation occurs that alters an anticodon in a tRNA from 3-AAU-5 to 3-AUU-5. What effect will this mutation have on protein synthesis?
If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of mRNA and the DNA nontemplate strand not identical? Could they ever be?
A scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this itiRNA makes when it is translated?
1. a)What are the two types of ncRNA used in translation? b.) How is translation terminated when the ribosome reaches a stop codon?
1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
2b) Once an RNA polymerase has initiated transcription, it will release the sigma factor or sigma subunit and bind other proteins known as elongation factors before it begins moving down the DNA template doing strand elongation. Briefly explain why this is necessary - why can't RNA polymerase + sigma factor do all of transcription?
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
1. Why aren't ssb proteins necessary in transcription?
1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.