i need the answer quickly 8. Why are histamine and serotonin contents increased in the site of inflammatory?Explain the importance of this fact recollecting the biological function of thesecompounds. For the answer:a) list biological functions of histamine and serotonin in the human body:b) draw the reactions of histamine and serotonin synthesis, point out enzymes,localization, and necessity of coenzymes;c) specify the pathways of biological amines inactivation and draw the schemesof histamine and scrotonin inactivation.

Histamine is an organic nitrogenous compound which is synthesized from amino acid residue…

Answered: 8. Why are histamine and serotonin…

Science

Biochemistry

8. Why are histamine and serotonin contents increased in the site ol inila latory?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter40: Nervous Systems

Section: Chapter Questions

Problem 13TYK: Discuss Concepts In the 1930s and 1940s, prefrontal lobotomy, in which neural connections in the...

See similar textbooks

Related questions

Q: 1.The 22nd amino acids and the only amino acid * A. Selenocysteine B. Selenicysteine C. Carbocystei...

A: Since you have asked multiple questions, we will solve only first question for you. If you want any ...

Q: 1. Why is it important in Quantitative Analysis to postpone rounding until the calculation is comple...

A: A quantitative analysis is performed to detect the amount of specific substance in a sample solution...

Q: AP is a 35-yr old male presents with hypertension. His medications were known to work by inhibiting ...

A: Any of several naturally occurring amines that act as neurotransmitters and hormones in the body is ...

Q: During the formation of the peptide bond which of the following takes place? a. Hydrogen atom is lo...

A: Between the α-nitrogen atom of one amino acid and the carbonyl carbon of another, a peptide bond, al...

Q: is an amino acid that can be directly converted into a citric acid cycle intermediate by being expos...

A: Citric acid cycle is the final common oxidative pathway for carbs, proteins and lipid. Amino acids ...

Q: A catalase is an antioxidant enzyme that requires ferric ion for catalysis. Under conditions of iron...

A: - Option A- A prosthetic group is a non-amino acid component that is closely connected to the apopro...

Q: Matching type. Match the following disaccharides with their corresponding monosaccharide units Galac...

A: Disaccharides are the class of carbohydrates that consist of two monosaccharides joined covalently b...

Q: 2. 1 Calculate the overall charge (pH 7) on the following three polypeptides and answer the question...

A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which on...

Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT ATGGGCCATATTGCGACC...

A: DNA strand given here with directionality is as: 5’ TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCCAAA...

Q: Arrange signalling cascade events in chronological order. ...

A: Signaling pathways helps to respond the cells according to the external stimuli. The external stimul...

Q: Assessing the efficacy of glucosamine and chondroitin sulfate for arthritis pain Treatment with...

A: Many patients with arthritis, particularly osteoarthritis, utilise vitamins in their diet to relieve...

Q: What are the types of genes and their functions ?

A: Introduction: Gene is a basic unit of hereditary information and it determines the inherited charact...

Q: Use the image below to determine what stage of the dog's life cycle is spent in the haploid state? (...

A: Haploid stage is the condition at which cell contains only one set of chromosomes in its nucleus Dip...

Q: 1. Which of the following molecule can act as molecular chaperons for assisting the folding of prote...

A: A broad set of unrelated protein families whose function is to stabilise unfolded proteins, unfold t...

Q: Enumerate the main structural features of nucleosides and nucleotides

A: There are 4 biomacromolecules; protein, carbohydrate, lipid and nucleic acids. In these, nucleic aci...

Q: ODD MAN OUT. Which of the following is not related to the other choices below? adenylyl cyclase inos...

A: Signaling is the process of communication between the cells, and between the cells and the extracell...

Q: Draw the basic structure of a named lipid and identify its 2 main types of component.

A: A lipid is any of a diverse group of organic compounds that are insoluble in water. They include fat...

Q: The glycerol-3-phosphate shuttle can transport cytosolic NADH equivalents into the mitochondrial mat...

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since yo...

Q: Most of the ultraviolet absorption of proteins at 280 nm is due to their content of O Tryptophan O A...

A: Proteins in solution absorb UV light at 280 and 200 nm, exhibiting absorbance maxima at these wavele...

Q: In kappa and iota carrageenans, gels are formed through double helical formation of two polysacchari...

A: Carrageenans are polysaccharides comprised of repeating disaccharide units of sulfate derivatives ga...

Q: king of acid

A: Acid is the substance which turns blue litmus to red. Acid contains more H+ ions. Acids acts as prot...

Q: Consider a protein with a beta conformation sequence EAGQVHRGP a) Which residue(s) can be substitute...

A: Beta conformation in protein: Beta sheet, beta-turn etc are beta conformation in protein. Beta sheet...

Q: write about a Famous Case of someone with Li-Fraumeni Syndrome

A: Li-Fraumeni syndrome is a rare hereditary disorder that predisposes carriers to cancer development. ...

Q: Biochemistry Question: Give one example of 5-Carben Sugar

A: Introduction: A five-carbon sugar found in the DNA is deoxyribose. It forms the central molecule in ...

Q: Colchicine is used to treat gout. It alters cytoskeleton function. Why do you think it is useful for...

A: Gout is a frequent and complicated form of arthritis that can strike anyone at any time. It's charac...

Q: D-Erythrulose in cyclic form:

A: Erythrulose is chemically teterose carbohydrates.formula for erythrulose is C4H8O4. It is used in co...

Q: Consider the following portion of mRNA: 3'-CUU-AAA-CGA-GUU-5' What is the primary amino acid structu...

A: mRNA(messenger RNA) carries the genetic information copied from DNA in the form of a series of tripl...

Q: Explain when "formulated media" was chosen to be used as a medium in the fermentation process? Menti...

A: A growth medium, also known as a culture media, is a solid, liquid, or semi-solid that is used to he...

Q: Which of the following cause and effect relationships below is incorrect? higher ligand bindi...

A: Which of the following cause and effect relationships below is incorrect? higher ligand binding: in...

Q: Which of the following samples are expected to cause a decrease in absorbance over time when perform...

A: Ensuring adequate light reaching a detector by using water colloidal solutions in light or X-ray be...

Q: Iculate the actual, physiological deltaG for the reaction Phosphocreatine + ADP > creatine + ATP at ...

A: Disclaimer: Since you have asked multiple question, we will solve the first question for you. If you...

Q: Uncatalyzed -Enzyme A - Enzyme B C12H22011 + H,0 2C,H,,0. For the reaction shown, it can reasonably ...

A: Enzymes are biocatalysts which increase the rate of biochemical reactions by decreasing the activati...

Q: Analysis of a octapeptide revealed the presence of the following products: 2 Arg, 1 Gly, 1 Met, 1 Tr...

A: Edman Degradation – This is method of peptide sequencing. In this method amino terminal residue is l...

Q: Linolenic acid and Linoleic acid, the essential fatty acids, are respectively, * A. 16:1 and 18:1 ...

A: Linolenic acid and Linoleic acid:- both are essential fatty acids ( makes hormones, regulate immune ...

Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase ...

A: Reaction catalyzed by Pyruvate carboxylase is given below; Pyruvate + CO2 + ATP + H2O →Pyruvate carb...

Q: Which of the following saccharides is INCORRECTLY described? * A. D-mannose: Monosaccharide: P...

A: Carbohydrates are macronutrients that the body requires for energy production. Carbohydrates provide...

Q: What are nucleosides?

A: Nucleic acid are the largest biomolecules which are found in genetic information. There are two comm...

Q: Explain the principle involved in blood typing.

A: The most significant blood typing is based on ABO groups, though 20 different blood groups are known...

Q: Protein solubility

A: here they are talking about protein solubility. Protein solubility is a thermodynamic property defin...

Q: Some mice have a mutation in the liver isozyme of pyruvate kinase leading to an inability to be phos...

A: Pyruvatw kinase in an enzyme which is involved in the glycolysis process. In Glycolysis, the cycle A...

Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase ...

A: Glucose is degraded to pyruvate through the process of glycolysis that occurs in the cytoplasm. Glyc...

Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They...

A: Ezymes are boost up chemical reaction in body.allosteirc enzyme are type of Ezymes.Allosteric enzyme...

Q: Describe in as much detail as you can, the fluid mosaic model of a cellular membrane.

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any ...

Q: Comparing stearate to palmitate, concerning beta oxidation, how many more ATP will be formed from st...

A: After each cycle of beta oxidation, the fatty acid gets reduced by 2 Carbons and the end products ar...

Q: ideroblastic anemia is observed in the deficiency of which of the following? * (Please choose one co...

A: Vitamins are the organic compounds required for the proper functioning of the body. The vitamins are...

Q: 1. What is the physiologic function of pigments in plants?

A: Pigments are compounds that absorb specific wavelengths and reflect away, the other. Plant parts are...

Q: The restriction digests of the cloned Drosophila gene can provide direct visible evidence of a mutat...

A: We can use the technique of Southern blotting to detect and isolate the DNA fragment with the Gene O...

Q: Which of the followingdescribe superior properties of enzymes (biological catalysts) over traditiona...

A: Enzymes are biocatalysts that are protein in nature. They Enzymes present a the particular substrate...

Q: What is not an example of a reactive oxygen species (ROS)? 1. superoxide 2. hydroxyl radical...

A: Introduction: Reactive oxygen species are also referred to as free oxygen radicals. It is a highly r...

Q: 2 Two version of the same enzyme were isolated, a wild type and a mutant differing at a single amino...

A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation energy...

Question

i need the answer quickly

8. Why are histamine and serotonin contents increased in the site of inflammatory?
Explain the importance of this fact recollecting the biological function of these
compounds. For the answer:
a) list biological functions of histamine and serotonin in the human body:
b) draw the reactions of histamine and serotonin synthesis, point out enzymes,
localization, and necessity of coenzymes;
c) specify the pathways of biological amines inactivation and draw the schemes
of histamine and scrotonin inactivation.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1 Introduction

VIEW

Step 2 Answer and explanation

VIEW

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

Some drugs and toxic compounds interfere with removal of neurotransmitters from the synaptic cleft once they have been released. (1) Explain the two basic mechanisms affected by Sarin nerve gas and the drug Prozac. (2) If you were investigating an autoimmune disease that appeared to interfere with removal of neurotransmitters from the synaptic cleft, and you were able to isolate the causative antibody from the patient's serum, how could you use that antibody to investigate whether it affected one of the two inactivation mechanisms?
4. "Selective NSAIDs can reduce inflammation and pain". Briefly explain this statement. Use your own words asap?
1. Why is the use of monosodium glutamate (MSG) highly debated?
1. What cellular event happens in response to the binding of a growth factor to its respective receptor on the membrane of the growth factor’s target cell? Describe what happens to a tyrosine kinase receptor once it binds the growth factor signal. 2. Describe the three domains of a receptor tyrosine kinase. Explain the structure of the transmembrane domain and the amino acid composition and arrangement of this part of the receptor PLEASE ANSWER BOTH
233. Which of the following statements is true about chemokines such as CXCL-8? A. They are powerful activators of inflammation b. They are mainly mediators of the antiviral response c. They are mediators of chemotaxis d. Directly stimulate the growth of immune system cells in the bone marrow
Describe how the sensory-somatic nervous system reacts by reflex to a person touching something hot. How does this allow for rapid responses in potentially dangerous situations?
Cite evidence supporting a long evolutionary history for cell signaling molecules.
In addition, receptors can be inactivated in at least three other ways. What are they?
12. A natural protectionn against virus is the production of interferon by virally infected cells. The antiviral activity of interferon is due to which of the following? (a) Altering the fluidity of the plasma membrane and thereby preventing virus envelopment (b) Binding to the surface of viruses and preventing their attachment to cells (c) Binding to viral genomes and blocing their trnscription (d) Competing with viruses for viral receptors on the surface of host cells (e) Inducing cellular proteins that degrade RNA and block protein synthesis
10. Explain how scaffold proteins help the efficiency of the AMP kinase cascade. Why is it important that the interaction of the scaffold with the MAP kinases is NOT a very stable interaction?
For many years it was a complete mystery howcytotoxic T cells could see a viral protein that seemed to bepresent only in the nucleus of the virus-infected cell. Theanswer was revealed in a classic paper that took advan-tage of a clone of T cells whose T cell receptor was directedagainst an antigen assoicated with the nuclear protein ofthe 1968 strain of influenza virus. The authors of the paperfound that when they incubated high concentrations ofcertain peptides derived from the viral nuclear protein, thecells became sensitive to lysis by subsequent incubationwith the cytotoxic T cells. Using various peptides from the1968 strain and the 1934 strain (with which the cytotoxic Tcells did not react), the authors defined the particular pep-tide responsible for the T cell response (Figure Q24–1).A. Which part of the viral protein gives rise to thepeptide that is recognized by the clone of cytotoxic T cells? Why do not all viral peptides sensitize the target cells forlysis by the cytotoxic T…
Aspirin is a non-steroidal anti-inflammatory drug (NSAID) that inhibits the formation of blood clots and is taken regularly by individuals with a heart condition. Steroids such as cortisol are used to control some autoimmune diseases and severe arthritis by down regulating the inflammatory response. After reading the role of inflammation in the bodys response to infection, can you predict an undesirable consequence of taking anti inflammatory drugs on a regular basis?