What is the difference between micro and macro nutrients? Elaborate your answer.

Q: A scientist hypothesizes that dysregulated insulin signaling is responsible for the development of…

A: Metabolic syndrome A cluster of conditions that increase the risk of heart disease, stroke and…

Q: Describe the process of Translation of MRNA to DNA.

A: Translation is the second phase of protein synthesis. It follows transcription, in which the…

Q: When comparing Gastropoda with bivalvia, is the relationship monophyletic, polyphyletic, or…

A: Mollusks are soft-bodied animals and the body is divisible into visceral mass and foot. The visceral…

Q: Marie diluted her phage lysate from 10° to 109. She completed the titer assay protocol using these…

A: This question is about dilution.

Q: Provide an example of a well known group (taxonomic) name that has been rendered non-monophyletic…

A: Answer :- Taking care of the fundamentals of  taxonomy categorization and how to peruse phylogenetic…

Q: mechanisms of resistance to different xenobiotics (general groups of protection, efflux pumps,…

A: Xenobiotics are chemical substances in animal body which are not natural to be found in animal or…

Q: What is dna?

A: Answer

Q: Is there a difference in the absolute values of force generated by females and male in EMG? Yes or…

A: An individual's dominant arm is the one that is used the most frequently. The two arms generate…

Q: 2. If the yeast do not grow on your selective media plates, describe at least two different errors…

A: When growing yeast in a selective plate the major error in various cases is the contamination of…

Q: Which of the following signs is most often observed in acute and chronic alcoholism? OA. Barret…

A: Alcohol poisoning is a condition caused by the rapid and excessive consumption of alcoholic…

Q: Describe the process of Translation of MRNA to DNA.

A: The process of the process from a DNA strand into a new RNA ( mRNA ) molecule is known as…

Q: Septic shock is life - threatening condition caused by an overwhelming

A: Septic shock- it is a condition sometimes occurs  in severe sepsis, in which the blood pressure…

Q: The bacterium Clostridium difficile (sometimes abbreviated C. diff) is a gut bacterium that can…

A: The clostridium bacterium is found in  colon which is the reason of many colon or digestive tract…

Q: With a diagram trace the movement of electron during the LRP of photosynthesis.

A: Photosynthesis is a process in which carbon dioxide and water is used up as raw material along with…

Q: Sex linked 6. traits are those found on the chromosomes determining gender, and show up more often…

A: Multiple allele is a condition and according to that, In a gene there are more than two alternate…

Q: in a paragraph discuss some examples of the effects of chromosomal mutations in humans in your own…

A: The majority of mutations develop when the DNA fails to duplicate correctly. All of these mutations…

Q: Besides the Warrior gene, the only other genetic mutation directly correlated with “super-maleness”…

A: As mentioned in many scientific literature the warrior gene which is normally referred to as MAOA…

Q: 16. In amphibian embryos, BMPS act on ectodermal cells in concert with Wnts to form the epidermis.…

A: Developmental biology describes how interacting mechanisms generate an organism's various size,…

Q: Which of the following gene expression regulatory mechanisms saves the most energy but takes the…

A: Post-translational control- this mode involves modification of an already synthesized protein. it is…

Q: Match the description with the type of evidence of evolution they belong to. 1. Homologous…

A: Evolution is the change over time. It is the unifying theory of biological science. There are many…

Q: Discuss in details, the adaptations that Orobanchaceae (plant) has evolved to invade and manipulate…

A: Introduction Orobanchaceae:- It is a family of mostly parasitic plants of the order Lamiales, It is…

Q: O5-CAGCAUUA-3'

A:

Q: BLASTP helps to predict the function of phage proteins by finding the e-value of phage proteins O…

A: ANSWER) (a) finding the e-value of phage proteins The BLASTp helps to predict the function of phage…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: Why do some scientists use immersion fluids when looking at their microscope slides? Increases the…

A: One of the problems in light microscopy is to overcome the limits of the optical resolution and…

Q: Question 1) Answer yes or no to the following questions. Scenario (A) A researcher uses a model from…

A: A. Viable population is capable to maintain itself and able to survive in opposite conditions.…

Q: What causes allele frequencies to differ between biological populations?

A: Allele  frequency  Allelic frequency can be defined as relative frequency of an allele at a…

Q: presentation of the viral spike protein on MHC I? Describe the cellular response, ending with the…

A: Class 1 MHC proteins on the surface of most cells displays peptide that are formed by proteolysis of…

Q: Describe the properties of the genetic code - how many codins code for amino acids, stop colons,…

A: The genetic code can be defined as a set of specific rules for a living cell to translate…

Q: 2. The largest population an ecosystem can support is the carrying capacity determine by the which…

A: Ans: 2 Carrying capacity, limiting factors  Explanation: The largest population an ecosystem can…

Q: vessel.   Viscosity has implications on the flow rate through a tube or vessel.  Viscosity of plasma…

A: High viscosity of blood indicates the low blood flow and high blood pressure which is abnormal…

Q: Angiotensin is a hormone that stimulates vasoconstriction and increases blood pressure. Which effect…

A: Answer :- Option (D) is correct. - decreased reabsorption of sodium in the kidneys.

Q: Question 27 To make RNA the nucleic acid sequences get read in the directi -- Sense → Antisense O…

A: Nitrogen-containing bases, phosphate groups, and sugar molecules make up nucleic acids. Each nucleic…

Q: From the early 1700s to the modern day, how did various lines of evidence refine scientists'…

A: Cetacean is classified as a group that comprises whales, and dolphins along with the porpoises.…

Q: For the following sequence, transcribe and translate the sequence into a protein. Be sure to…

A: Given strand is DNA template strand- 3'-TACCACCCCCTGAGTGCTGGGATC-5' Transcription of template Strand…

Q: A hypothetical population was found to have a genotype frequency of AA=20%, Aa=40%, aa=40%.  What…

A: Hardy-Weinberg provides the null hypothesis that links the alleles and the genotypes in the…

Q: The distinction between SLA and HDD may be explained as follows:

A: Disease It is a particular abnormal condition that negativity affects the structure or function of…

Q: We have the following DNA sequence that codes for 7 amino acids of exon 1 of the dopamine receptor…

A: Here the DNA sequence is - 5' GTG CAC CTG ACT CCT GAG AAG 3' It codes 7 aminoacids.  The…

Q: CONCENTRATION (NG/ ML) ABSORBANCE 655 NM (AU) 0.695 0.699 1000 500 250 0.587 125 0.513 63 0.385 31…

A: ELISA stands for enzyme-linked immunosorbent assay. It is a commonly used bio-chemical assay, that…

Q: Theoretical and Actual Growth of E.coli bacteria Time Generation Hours Minutes 1 2 3 4 LO 5 6 7 0 0…

A: Introduction The term "population" usually refers to the number of people living in a specific area,…

Q: During replication, initiation is done by an RNA primase putting in an RNA Primer. Why is it that an…

A: DNA polymerases need a primer oligonucleotide (RNA or DNA) - their substrates are an existing 3'-OH…

Q: Create an artwork portraying the prokaryotic cell (one for archaea and one for bacteria). Explain…

A: Both Archaea and Bacteria are unicellular organisms. In this way they are different from eukaryotes,…

Q: What function do the malleus, incus, and stapes bones in the inner ear play in processing sounds?…

A: The malleus, incus, and stapes bones also known as auditory ossicles . Present in the Inner ear .…

Q: Yeast cells has been cultured on glucose (Table 1). The growth data follows the Monod Equation Table…

A: I gave you the answers below. Thank you.

Q: If the first G changes to A what kind of mutation will happen? Show the change in amino acid…

A: When there is an error in the DNA sequence during replication it causes a change in the DNA…

Q: Give the economic and ecological importance of Sugar cane (Saccharum)

A:

Q: F E D H 1-09 G H life cycle life cycle A C B

A: Virus is a minute entity just like other microbe but have small size.  It has dua nature . It behave…

Q: Chemiosmosis

A:

Q: You have cloned the protein coding region of the porin gene from a phage into a bacterial cell for a…

A: Generally the phage viruses don't have a transcription or replication machinery they are dependent…

Q: The concept that traits in parents are mixed together to form an intermediate condition in their…

A: Answer : Option (2) is correct. - blending inheritance.

Regulation and motivation

The strategies with which individuals undertake to regulate and manage their learning are referred to as self-regulated learning (SRL). Motivation is important in self-regulated learning. The regulation necessitates some level of choice or intentional selection of approaches to assist the learner in achieving a goal or behavior. Self-regulation is referred to as self-generated ideas, emotions, and behaviors that are strategically organized to affect an individual's learning (Schunk & Zimmerman, 2007).