Assume that the nucleotide at the 5′ end of the first tRNA’s anticodon (the tRNA on the left) in Figure 15.11 was mutated from G to U. Give all codons with which the new, mutated anticodon could pair. SerSerTRNA1 Pairing at the thirdcodon positionis relaxed.Anticodon.Wobble3'AGG 5'UCC3'AGG S' positionUCU 3'5'Codon2 G in the anticodoncan pair with C...3...or with U.15.11 Wobble may exist in the pairing of a codon and anticodon.

Name: Assume that the nucleotide at the 5′ end of the first tRNA’s anticodon
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Assume that the nucleotide at the 5′ end of the first tRNA’s anticodon (the tRNA on the left) in Figure 15.11 was mutated from G to U. Give all codons with which the new, mutated anticodon could pair. SerSerTRNA1 Pairing at the thirdcodon positionis

The 61 codons codes code for 20 different amino acids. So, there must be 61 different tRNA…

Science

Biology

Ser Ser TRNA 1 Pairing at the third codon position is relaxed. Anticodon. Wobble 3'AGG 5' UCC 3'AGG S' position UCU 3' 5' Codon 2 G in the anticodon can pair with C... 3...or with U. 15.11 Wobble may exist in the pairing of a codon and anticodon.

Ser Ser TRNA 1 Pairing at the third codon position is relaxed. Anticodon. Wobble 3'AGG 5' UCC 3'AGG S' position UCU 3' 5' Codon 2 G in the anticodon can pair with C... 3...or with U. 15.11 Wobble may exist in the pairing of a codon and anticodon.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1CT

See similar textbooks

Similar questions

13c give the codon sequences of every code on this tRNA with the anti-codon 5AAG3, could pair with including wobble matches
Provide the DNA sequencce (not RNA sequence) for the Start Codon and 3 Stop Codons.
1b) Give the anticodon of the tRNA that would be complementary or a perfect match to the codon 5'AGG3'.
2c) Give 3 different tRNA anticodon sequences that could be mutated by a single base substitution into that suppressor tRNA anticodon (the one that would match and suppress the 5'UAA3' stop codon) and name the amino acid that would be carried by each tRNA whose anticodon you have listed
Explain The mRNA codon of valine is: GUC UGG CCA TTG
From the picture provided, which colored option (exon variant) will give me: 1. start codon 2. Stop codon Im not sure how to identify with exon out of the 15 exon varients provided which one has the start codon and which has the stop I need to filter these colored options in order to find my start codon and stop codon
i INSERTED make an insertion mutation by inserting a C after the 4th codon. Click show protein. Ø What effect does this mutation have on the polypeptide? Compare to the original polypeptide. Ø What is the resulting polypeptide: Ø Would this mutation allow the protein for perform the intended function? Why or why not?
1e) Give the sequence of every codon this tRNA, with the anticodon 5'AGG3', could base pair with (perfect and wobble matches), and name the amino acid coded for by each codon whose sequence you have written.
A short RNA molecule was isolated that demonstrated a hyperchromic shift indicating secondary structure . Its sequence was determined to be 5'@AGGCGCCGACUCUACU@3' If the molecule were a tRNA fragment containing a CGAanticodon, what would the corresponding codon be?
a) Identify the current stage of the translation process shown in Figure 1 and name the anticodon sequence in tRNAb) State TWO immediate, main consequences when a stop codon reaches the E site.
From the given DNA base sequence indicated below: 5’’AGCCCATATGGCCCATACGCGGAATCGC 3’ Give the codon sequence and anticodon that will interact from the codon sequence Write the amino acids produced from the codon sequence.
Some mitochondria use a second codon, in addition to AUG, to specify Met. Which codon(s) is (are) most likely to be used this way?