Which statement is correct? OA cap is removed from the 5' end of a DNA molecule A сар A poly-A tail is added to a DNA molecule OA cap is removed from the 5' end of a pre-mRNA molecule OA poly-A tail is added to a pre-MRNA molecule

Q: Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA:…

A: INTRODUCTION The DNA and it's corresponding mRNA is given below.

Q: AAAC G CA G CCG Phe Gly Arg

A: In this image, we are shown the formation of proteins from DNA by following the central dogma of…

Q: The diagram shows part of a pre-mRNA molecule. A G part X (a) (i) Name the two substances that make…

A: Within the cells two types of nucleic acids are found, that are DNA and RNA. They both composed of…

Q: During the transcription of DNA to mRNA, __________. Group of answer choices a) RNA polymerase moves…

A: RNA polymerase moves in the 3' to 5' direction and the RNA strand transcribed comes out in  5' to 3'…

Q: Which amino acids are coded for by the mRNA strand: AUG UCA CGA GGU? methionine, leucine, alanine,…

A: DNA is the genetic material present within the nucleus in the cell. It maintains the heredity of the…

Q: Self-bonded and looped sequences near the end of single poly-ribonucleotide chains control gene…

A: Gene is the sequence of nucleotide that encodes a specific protein.

Q: Researchers are designing and testing antisense drugs as therapies for a variety of diseases,…

A: An antisense drug is a medication containing part of the non-coding strand of messenger RNA, a key…

Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…

A: Hi, Thanks For Your Question.  Answer : Let's Learn Some Basic Concepts First: Transcription : It Is…

Q: Portions of eukaryotic mRNA sequence that are removed during RNA processing are ________. a. exons…

A: The genetic material of a cell or an organism refers to those materials found in the nucleus,…

Q: Which of the following is false regarding mRNA processing? O The poly A tail that is found on the 3'…

A: mRNA processing mainly involves 3 steps- splicing addition of 5'end cap and 3'end polytail A…

Q: A type of RNA that has a “clover-leaf shape” with three hairpin loops. A.hnRNA B.rRNA C.mRNA…

A: RNA or Ribonucleic acid is a polynucleotide composed of ribonucleotides. These are formed from DNA…

Q: Tightly coiled DNA is ________.   a. known as hypermethylated   b. translationally regulated   c.…

A: Tightly coiled DNA is transcriptionally inactive. The DNA is tightly packed with histone proteins in…

Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…

A: In bacteria, RNA transcripts are ready to act as messenger RNAs and get translated into proteins…

Q: Which of the following is NOT a part of transcription? O Double-stranded DNA is unwound and forms a…

A: Transcription is the process of copying genes in DNA into mRNA sequence where they form…

Q: Describe the process of transcription. Your answer should be at least a full paragraph (3-7…

A: Question - Describe the process of transcription. Your answer should be at least a full paragraph…

Q: Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence…

A: Introduction :- The proteins are synthesized with the help of protein synthesizing machinery which…

Q: The portion of the mRNA that is removed during splicing is (a) an inverted repeat (b) the promoter…

A: The protein synthesis is a process which involves two steps transcription and translation .…

Q: Considering each nucleotide sequence in an mRNA molecule: [1] write the sequence of the DNA template…

A: Gene expression is the process by which the instruction in the DNA is converted to products through…

Q: Write the polypeptide sequence that would be translated from your mRNA sequence.

A: Answer -  The DNA sequence will be -  5' CTATAAGGCGCAAATCCCTGCCAT 3' - Non-coding strand 3'…

Q: A nonsense mutation in a gene:   A. introduces a premature stop codon into the mRNA   B.…

A: Any permanent change or alteration occurred in the DNA sequence is termed as the genetic mutation.…

Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…

A: The mRNA is produced by the process of transcription. It takes place in the nucleus. The RNA…

Q: Which of the following is true about transcription? O transcription begins at a start codon and ends…

A: Transcription is the process of making RNA from the template strand of DNA. It takes place in the…

Q: RNA processinga. removes the exons, leaving only the introns.b. is the same as transcription.c. is…

A: Transcription is the first step of gene expression that involves the formation of RNA molecule from…

Q: What will happen if RNA polymerase fails to attach to the promoter? O Translation Will begin early.…

A: Introduction "Transcription Is The Process Of Formation Of An RNA Molecule From DNA".  One Of The…

Q: A promoter: is a small stretch of DNA that binds to proteins that initiate transcription is a small…

A: A promoter is a small stretch of DNA that binds to proteins that initiate transcription.

Q: The reading frame of a protein is determined by the first nucleotides in the mature mRNA sequence.…

A: The translation process is the protein synthesis process within a cell. mRNA coding is translated…

Q: Convert the DNA template to mRNA.  Then, convert the mRNA  to tRNA. Based from the resulting…

A: Central dogma- RNA is produced from DNA with the help of transcription and then RNA is converted to…

Q: A codon is: three amino acids on a polypetide that are snipped off by the helicase enzy O sets of…

A: There are total of 64 codons coding for Amino acids.

Q: A. Below is a DNA sequence. Write the sequence of mRNA codons that would result from the…

A: According to the question, a DNA sequence is given. We have to find out the sequence of mRNA codons.…

Q: 5′ capping is the first step in ......... processing.   a. mRNA   b. tRNA   c. pre-RNA

A: 5' capping is the first step in mRNA  processing.  In the first nucleotide in the transcript during…

Q: What is the function of the 3'UTR in the RNA ? Check all that apply V The 3' UTR increases mRNA…

A: Three prime untranslated region(3'-UTR) Section of mRNA that immediately follows the translation…

Q: Bēlöw is thế TEMPLATE strand of DNA for a particular gene. Template strand: 5' AATCАTAAСТСАТTG 3' A.…

A: The two types of strands in DNA are coding (non-template) and template (non-coding). Both strands…

Q: Which of the following help(s) to stabilize mRNA by inhibiting degradation?   a. Introns   b.…

A:

Q: If you were to hybridize a eukaryotic gene to its corresponding mRNA, the two molecules would not…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Which characteristic of mRNA is INCORRECT? Bacterial mRNAs vary in size but usually have about 1000…

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: Researchers are designing and testing antisense drugs as therapies for a variety of diseases,…

A: The antisense gene therapy is a form of treatment for genetic disorders. This therapy is also…

Q: What is the effect of the insertion of a nucleotide in the 4th codon of the DNA sequence below?…

A: There are two strands of DNA :- template and coding strand . Template strand read in 3' to 5'…

Q: 11. Transcription is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…

A: Gene is the structural and functional unit in the DNA. Genes are composed of nucleotide nitrogenous…

Q: B- TRANSCRIPTION 1. Use the DNA code provided to copy an mRNA message. (DNA) a. TAC GGA CAT (DNA) b.…

A: The central dogma explains that the information from the DNA will be passed in a sequence fashion…

Q: Which statement is CORRECT? O the primary transcript of RNA is larger than the mRNA O the primary…

A: A gene is a stretch of nucleotides present in the DNA molecule. It encodes information for the…

Q: Which pre-mRNA processing step is important for initiating translation? a. poly-A tail b. RNA…

A: RNA processing comes after the transcription (DNA to mRNA), where the synthesized mRNA is only being…

Q: What is the sequence of the MRNA codon that binds to the anticodon 3'-AAG-5'? 5'-AAG-3' 5'-TTC-3'…

A: Anticodon:  A trinucleotide sequence that is complementary to a matching codon in a messenger RNA…

Q: The binding of an enhancer O stimulates transcription of a specific gene. O stimulates splicing of a…

A: The binding of an enchancer stimulates transcription of a specific gene , such as enchancer sequence…

Q: Which statement about transfer RNA (TRNA) is NOT correct? Select one: O It folds up into the shape…

A: Transcription in the process which is responsible for synthesis of RNA from the template strand of…

Q: If a stretch of mature mRNA to be translated has 300 bases, the resulting peptide will have O 300…

A: Amino acids are chemical molecules that contain the functional groups amine (NH2) and carboxyl…

Q: The number of amino acids produced by translating the mRNA (3'AUGCUUAGUCGCGUA5') is :   a. 4 b. 5…

A: The three letter codes for amino acids are the universally accepted amino acid codes that are…

Q: Which of the following provide clues that a particular DNA sequence is part of protein-coding gene?…

A: A protein-coding gene is a DNA sequence that instructs the cell to create a specific protein.…

Q: 85 __________ is the sequence motif located downstream from the Inr core promoter motif. A. BRE b.…

A: 85 __________ is the sequence motif located downstream from the Inr core promoter motif.   A. BRE b.…

Q: The DNA sequence of a gene is CCATGCT A. The corresponding mRNA produced from 6. this gene is a.…

A: The protein synthesis consumes large amount of a cell’s energy as compared to the other organic…

Q: The promoter region of a gene consists of a TATA box. What is the significance of this region? It is…

A: The gene expression is also known as the transcription process by which RNA is produced from DNA…

Fungal Infections

Fungal infection can be defined as an infectious disease caused by fungi. A fungal infection is also referred to as mycosis. Fungal infections are contagious, spreading from person to person. Mycosis can be contracted even from an infected animal or contaminated soil. The most common symptom is skin rashes and vaginal discharge in females.