Below is a small stretch of DNA in the middle of a gene. What amino acid sequence would be encoded by this small stretch of DNA if the top stand served as the template? 5' GTCGATCGCATG 3' 3' CAGCTAGCGTAC 5' UGU Cys UGCS Stop Trp UUU Phe UUC S UUA UCU UCC UCA UCG. UAU UAC S UAA Stop UAG S Tyr Ser UGA UGG Leu UUG CUU CỤC CUA CCU ССС ССА СCG CAU His CAC СА CGU' CGC CGA CG. Leu Pro Arg Gln CUG CAG AGU Ser AGC S AGA AAU AUU AUC AUA AUG ACU ACC АСА ACG lle Asn Figure 9 AAC S AAA Lys Thr Met AGG Arg AAG GUU GUC GUA GUG. GAU Asp GAC S GGU GGC GCU GCC GCA Val Ala Gly GAA GAG GGA GGG Glu GCG
Q: Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein…
A: Transcription is a process from central dogma where a DNA strand is used as a template to synthesize…
Q: The length of the SURF1 gene is 15, 914 bases. This gene is comprised of 11 exons and 10 introns.…
A: Ans. The gene has specific sequences which are important for the transcription of the gene. One of…
Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…
A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…
Q: WILD-TYPE MC1R GENE (LIGHT COAT-COLOR PHENOTYPE) DNA GTG TAC GAA CGT mRNA Amino Acid
A: MC1R gene It provides instructions for making a protein called the melanocortin 1 receptor. This…
Q: The length of the SURF1 gene is 15, 914 bases. This gene is comprised of 11 exons and 10 introns.…
A: In the diagram shown SURF1 gene. SURF1 gene is present at 9th chromosome & produces surf…
Q: EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA…
A: Given sequence of EboV strain 1 is CTA TGC AAG CAG TTA and strian 2 is TCA TGT CAG CAA CTA.
Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…
A: According to the question, we have to answer the question that which is for the chromatograph below,…
Q: The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…
A: The central dogma of life involves DNA replication, transcription, and translation into proteins.…
Q: You obtained the sequence of the frog gene X you amplified in Question #16 through a process called…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA…
A: A missense mutation is a mistake in the DNA which results in the wrong amino acid being incorporated…
Q: The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3'…
A: Transcription is the process by which the information in a strand of DNA is copied into a messenger…
Q: Which of the following represents the sequence of an RNA transcript for which the template strand of…
A: The deoxyribonucleic acid (DNA) is the nucleotide sequence that stores the genetic information of an…
Q: Match the activity below with the correct enzyme. (You won't use all the enzymes listed.) RNA acts…
A: DNA helicase is used during the DNA replication process where it binds to the double-stranded DNA…
Q: What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA…
A: There are two types of nucleic acids, DNA and RNA. Nucleotides are the building blocks of nucleic…
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-…
A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…
Q: If a point substitution mutation changes the sequence 5'ATGAAA3' to 5'ACGAAA3' in the MIDDLE of the…
A: Point mutation is a genetic mutation in which a single nucleotide base is altered, inserted or…
Q: TAC CTA CTC TAG TTA ACCACA GTT GCCATC Transcribe the given template strand of DNA:I Second mRNA base…
A: The Genetic code is : 1. Universal 2. Redundant 3.Non Ambiguous Genetic Codon have start and stop…
Q: A section of template DNA has the following sequence of nitrogenous bases: 5’-CGATTACTG-3’. Which of…
A: Template DNA sequence - 5’-CGATTACTG-3’ After transcription the sequence - GCUAAUGAC Explanation -…
Q: Below is a portion of an exon from a gene that encodes protein Y in the genome of the plant…
A: Ans 1 : Yes, there is a mutation in third codon when counting from 5/ to 3/ on template strand in…
Q: Which one of the following options would be a good way to identify the location of the poly A tail…
A: Pre mRNA undergoes several post-transcriptional modifications. One of these modifications is…
Q: a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1…
A: Transcription is a process in which a DNA strand is transcribed into mRNA by an RNA polymerase…
Q: How many potential methylation sites are present for the following DNA strand?…
A: 3 types of methylation sites. option 2 is the correct answer. Count the number of "C"s and "T"s at…
Q: Fill in the complementary DNA strands for the DNA strands below Which nitrogen base CAN'T you use…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Shown below is an E. coli's DNA sequence coding for XXR protein. The nucleotides are numbered 1 to…
A: Here I will provide you first 10 nucleotides long mRNA sequences according to question.
Q: Match each of the terms in the left column to the bestfitting phrase from the right column.a. exome…
A: a. Exome: It is the part of a genome that contains all the exons.b. de novo gene: These are the new…
Q: A template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA. Using the codon chart provided, what…
A: The template DNA strand, from which the mRNA is synthesized is as follows, 5' ATGGCTGGGTGCTTTTAA3'…
Q: Please asap Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the…
A: Given: Original DNA template: 3' - ACGGTCAATTTGCTG - 5'
Q: e. four-base, not overlapping4. An example of a portion of the T4 rIIB gene in whichCrick and…
A: The mutation is the alteration of the nucleotide sequence in an organism's genome. The mutation…
Q: You want to examine genetic variation in your gene promoter. You sequence DNA from several…
A: Single nucleotide polymorphism; it is a type of genetic variation which can occur throughout a…
Q: Following is the nucleotide sequence in a segment of a strand of DNA 5'- AATTGGCTCTATAAT-3' Give the…
A: Adenine, thymine, guanine, and cytosine are the bases of the DNA. The mRNA is a single-stranded…
Q: Part of the protein-coding region in a gene has the base sequence 3-…
A: Gene Gene is the part of DNA which code for polypeptide chain.
Q: Below are several DNA sequences that are mutated compared with the wild-type sequence. Each is a…
A: Note - Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: ’. Envision that each is a section of a DNA molecule that has separated in preparation for…
A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…
Q: These sequences are obtained as part of a human genome sequencing project using a library of 150 kb…
A: Contigs are the overlapping sequences present on DNA fragments. Each set of contigs is counted as…
Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…
A: Mutations in the DNA molecule are caused by a spontaneous alteration. After a synonym mutation, the…
Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…
A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: You see partial sequence of a gene as follows (non template strand shown)…
A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…
Q: A mature transcr Select one: a. 5' UTR b.introns С. ехons O d. Poly A ta e. guanine f.3' UTR
A: The 5′ untranslated region is the region of an mRNA that is directly upstream from the initiation…
Q: Here is a schematic map with a scale of a eukaryotic gene. How long is the primary mRNA transcript…
A: The mRNA is produced by the process of transcription.
Q: You are a researcher studying a gene you think is responsible for super human strength. You call the…
A: The two primers that is the forward primer and the reverse primer gets attached to different ends of…
Q: An original DNA sequence retrieved from the gametes of a female Golden Retriever and a mutated DNA…
A: DNA is two stranded structure , present bin double helix and is a genetic material in most of…
Q: In the table below, there are four versions of gene A, one of which is normal, and the other three…
A: Mutations are sudden heritable changes that change gene expression. These changes in gene expression…
Q: You are studying a gene containing three exons (exon 1 = 66 nucleotides , exon 2 = 99 nucleotides ,…
A: One strategy that can be used here is alternative splicing where different combinations of exons…
Q: You obtained the sequence of the frog gene X you amplified in Question #16 through a process called…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: In studying the mechanism of a particular enzyme, for which the cloned gene is available, you wish…
A: Site-directed mutagenesis is the molecular biology technique that alters the sequence of the target…
Q: The following DNA fragment shows where a number of restriction endonucleases cut sites occur within…
A:
Q: (i) For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…
A: The sequence of 15 to 125 derived from the chromatogram is AAATTGTTATC
Q: EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA…
A: Substitution mutation- substitution of a base pair for another during DNA replication is the most…
Q: In Figure 14-10, expressed sequence tags (ESTs) arealigned with genomic sequence. How are ESTs…
A: The full form pf EST is Expressed sequence tags. EST are the DNA sequences which are smaller in…
Do question 26 using the provided image
Trending now
This is a popular solution!
Step by step
Solved in 4 steps
- Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?For the following sequence design the forward and reverse primer... explain and justify your answer. Gene of Interest: a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg…Below is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?
- BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’
- Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF?The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAGThe following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA?
- The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all 5 groups and translate. Group A 5’-GGCAATGGGTTTGTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTTTCAAAAATTAAG-5’ Group B 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’ Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAGThe following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 3 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3' TACCACGTGGACTGAGGACTCCTC 5' . 5' ATGGTGCACCTGACTCCTGAGGAG 3' 3. What mRNA will be formed from the template strand of DNA? Sequence of mRNA formed from DNA template strand is shown below: 3' TACCACGTGGACTGAGGACTCCTC 5' . 5'AUGGUGCACCUGACUCCUGAGGAG 3 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is…In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash between each group of three bases. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG