Part 2. Dynamic Programming Assignment, Needleman-Wunsch Algorithm, Affine Gap Cost Align two sequences: horizontal - GGAATGG, vertical - ATG, m = 2, mm = 0, g/o = -2, g/e= -1. Complete the NW matrix below and show the alignment paths. Write down and score all optimal alignments.
Q: How much energy is required to synthesize a saturated C12 fatty acid? How does this compare with the…
A: Fatty acid synthesis occurs in the cytosol of all eukaryotic cells except plants (occurs in…
Q: A certain amount of white solid was dissolved in enough water and gives a colorless solution. A…
A: Carbohydrate: Also known as saccharides are often composed of monosaccharides, which are simple…
Q: Specificity is defined as: A. False positive rate of a test. B. True negative rate of a test. C.…
A: Introduction There are two kinds of tests used to assess people’s health, diagnostic tests and…
Q: Sm When proteins are solubilized in inclusion bodies from an E Coli cell lysate, they are unfolded.…
A: Plasminogen is an important enzyme which is present in blood and degrades plama proteins like…
Q: receptor/s b. the energy source c. if there is signal peptide cleavage or none E. Mitochondrion…
A: Major proportion of the mitochondrial proteins are encoded by the nuclear genes. These proteins are…
Q: Which of the following contains the largest number of r groups? Which contains sulfur? Please…
A: Amino acids are basic subunits of proteins/peptides. The alpha carbon of amino acids contains amine…
Q: An analysis is performed to determine the proportions of each of the four nucleotide bases in the…
A: The genetic material in the cells of most organisms is DNA or deoxyribonucleic acid. DNA is…
Q: phosphate. Contrast the properties of hexokinases I and IV with respect to oligomeric structure,…
A: Hexokinase is an enzyme that has the ability to transfer inorganic phosphate group from ATP to the…
Q: One of the hallmarks of competitive inhibition is that there is constant competition between the…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. They contain an…
Q: If your body sense that is very low on the substrates necessary to produce ATP homeostatic control…
A: Deamination of amino acids - it is the process of breakdown of amino acids which occurs in excess…
Q: *The enzyme glucose oxidase isolated from the mold Penicillium notatum catalyzes the oxidation of…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…
A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…
Q: Cyt cb562 will form a tetramer in the presence of Zn+2 or in the absence of Zn+2, it will form a…
A: INTRODUCTION : Cyt cb562 - Cytochrome cb562 is a variant of an Escherichia coli four-helix bundle…
Q: 4. You are to choose the members of an expedition that will climb several high mountains. Each…
A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: explain what coupled transcription-translation is, and why it occurs in prokaryotes but not…
A: According to the central dogma of molecular biology, the process of gene expression involves two…
Q: A biochemist wants to determine the effect of an inhibitor on a certain enzyme. The data are shown…
A: Inhibitors inhibits the enzyme activity. There are three types of inhibitors-Competitive,…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…
A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…
Q: For the following scenarios, determine whether the molecules in the scenario are moving by simple…
A: Biological membranes are structures that surround the cell or organelles and act as barriers. An…
Q: Recall that vmax is achieved only at high substrate concentrations. Based on your answers to…
A: Competitive inhibitors of enzymes resemble one of the substrates of an enzyme.
Q: What is the biochemical cause and effect of anemia in sickle cell disease?
A: Sickle cell anemia is a genetic disease (it is an autosomal recessive disorder). This affects the…
Q: When a peptide bond forms, a(n)________ reacts with an amine to form a(n). O aldehyde; aldimine O…
A: Introduction: A chain of amino acids that are linked by peptide bonds to form a protein. Peptide…
Q: ue about the Golgi Complex EXCEPT A number of stacks of differing compositions make up the…
A: Golgi apparatus or Golgi complex is a cytoplasmic organelle of smooth membrane sacs or cisternae.…
Q: *Write structures for the straight-chain (Fischer projection) formula and the indicated anomer of…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: What technique seperates proteins based on their ionic charge?
A: Proteins are high molecular weight polymers of amino acid residues, linked via a peptide bond. Amino…
Q: HO -NH₂ NH NH HN S-CH3 ΝΗ O The peptide chain has OH residues. The name of the peptide using single…
A: Peptides are small sequences of amino acids that are joined together through peptide bonds. Peptides…
Q: A mixture of five proteins are analyzed by MALDI-TOF. Their molecular weigths are 3 kD, 22 kD, 100…
A: Mass spectrometry is an analytical method that involves ionizing materials into charged molecules so…
Q: How many reduced molecules (NADH, FADH2, NADPH) will be generated by converting linoleic acid…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: Page 3 2) 7. J a) Glucosidase I catalyzes hydrolysis of specific glucosidase I is a synthetic…
A: Parameters such as Km and vmax are used for comparing enzyme activities. If we know the initial rate…
Q: A hypothetical enzyme that follows Michaelis-Menten kinetics functions has a substrate concentration…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: How will a graph of reaction rate (V) vs. [substrate] for an allosteric enzyme differ from the…
A: The enzymes are biochemical catalysts that enhances the rate of biological reactions. Most enzymes…
Q: State what each of the following symbols stands for, be specific. 4. M 5. SD 6. α
A: Introduction There are various symbols are used in science. Scientific writing requires various…
Q: 4. What is the sum of all the hydrogens at the highlighted carbon atoms in the given structure? A. 7…
A: The given structure is a hydrocarbon. By balancing the valency of carbon, we can calculate the…
Q: Yeast cells are grown with galactose as the sole carbon source and ATP levels are abundant. Describe…
A: GAL genes: The GAL genes, which include structural (GAL1, GAL10, GAL2, and GAL7) and regulatory…
Q: Consider the reaction: H H SCOA a. What kind of reaction is being performed here? b. What enzyme…
A: Fatty acid oxidation occurs on the outer mitochondrial membrane. The fatty acids must be activated…
Q: 2. The Km of a particular enzyme is 2.0 x 105 M. If the initial velocity (Vo) is 0.16 mmol/min for…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Which of the following amino acids is generally absent from an a-helix? tryptophan serine isoleucine…
A: The alpha helix is secondary structure of protein in which the amino acid chain is arranged in a…
Q: CONNECT Explain why the proton gradient formed du chemiosmosis represents a state of low entropy.…
A: Oxidation of glucose into pyruvate followed by oxidation of pyruvate into acetyl CoA and then…
Q: Which of the following is zwitterion structure of the amino acid alanine? O NH3 NH3 O NH₂ O OH O no…
A: Amino acids are biomolecules that have an amino group (-NH2), a carboxyl group (-COOH) and a side…
Q: Mutual intermediates of catabolism of proteins, carbohydrates and lipids; their role in the…
A: Catabolism is the process of breaking down of complex compounds into simple molecules. The catabolic…
Q: Which of the choices are types of posttranslational modifications a newly synthesized protein may…
A: Posttranslational modifications are the amino acid side chain modification in some proteins…
Q: A.Provide the name for the D-monosaccharide “1” in the above image. You may ignore the alpha or…
A: There are four classes of biological macromolecule: nucleic acids, proteins, lipids and…
Q: Give the systematic name for the disaccharide shown in the image by selecting the appropriate terms.…
A: Conformation is the different positions a molecule can twist into. Configuration is the arrangement…
Q: Lay out the steps in transcriptome analysis RNA-Seq and microarrays that lets you identify…
A: Researchers can describe the transcriptional activity (coding and non-coding), concentrate on a…
Q: Wheeler Johnson Principle: Reagents: Reaction: Substance Detected: Murexide Principle: Reagents:…
A: DNA/RNA are nucleic acids, the molecules responsible for carrying genetic information from one…
Q: C. TBARS Assay 1. In a test tube, mix 1 mL of the samples and 1 mL of thiobarbituric acid reagent.…
A: Sources of error can be defined as the factors which affect the accuracy and precision of an assay.…
Q: QUESTIONS: 1. Aside from carbohydrates, lipids and proteins, what other organic compounds are found…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: Explain the function(s) of each of the basal transcription factors (the TFII "alphabet soup")
A: Basal transcription factors are required for the initiation of the transcription or mRNA synthesis.…
Q: For an enzyme-catalyzed reaction, the velocity was determined at two different concentrations of the…
A: The velocity of an enzyme catalyzed reaction is given by: V=Vmax×SKM+SWhere,V=velocity of the…
Q: 3. Explain why the structure of myoglobin makes it function well as an oxygen-storage protein…
A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: Answer in brief sentences in your own words please thank you! 1. Soon after the bolus reaches the…
A: Starch is a complex carbohydrate. Starch digestion starts in the mouth but occurs mostly in the…
Trending now
This is a popular solution!
Step by step
Solved in 8 steps with 11 images
- Horizontal sequence :VIRL Vertical sequence:MKF Scoring rules: g/o = -3, g/e = -1, match or mismatch - from PAM250 substitution matrix below. SW algorithm. 1. Complete the scoring matrix. Scoring matrix with PAM250 scores: V I R L M K F 2. Set up, initialize and complete the SW matrix. 3. Retrace, align and score alignment(s). Use the arrows and circles for the matrix and path(s). V I R L M K F Align and score all optimal alignments here. PLZ the arrows and circles for the matrix and path(s) AND SHOW ALL possible AlignmentHorizontal sequence :VIRL Vertical sequence:MKF Scoring rules: g/o = -3, g/e = -1, match or mismatch - from PAM250 substitution matrix below. SW algorithm. 1. Complete the scoring matrix. Scoring matrix with PAM250 scores: V I R L M K F 2. Set up, initialize and complete the SW matrix. 3. Retrace, align and score alignment(s). Use the arrows and circles for the matrix and path(s). V I R L M K F Align and score all optimal alignments here.What does BLAST stand for? Basic Local Alignment Search Tool Basic Local Alignment SequenceTool Best Local Alignment Search Tool Best Local Algorithm Search Tool
- Horizontal sequence :RIVL Vertical sequence:FMK Scoring rules: g/o = -3, g/e = -1, match or mismatch - from PAM250 substitution matrix below. NW algorithm. 1. Complete the scoring matrix. Scoring matrix with PAM250 scores: R I V L F M K 2. Set up, initialize and complete the NW matrix. 3. Retrace, align and score alignment(s). Use the arrows and circles for the matrix and path(s). R I V L F M K Align and score all optimal alignments here. PLZ the arrows and circles for the matrix and path(s) AND SHOW ALL possible Alignment Here the following…Using the Dynamic Programming algorithm for pairwise local alignment we covered in class, construct the dynamic programming score table for a local alignment of the following two sequences, using the following scoring parameters: match score = +5, mismatch score = -3, gap penalty = -2.: ACGTATCGCGTATA GATGCTCTCGGAAAWhat is score of the best local alignment between these two sequences? Show the alignment of these sequences. asapPerform Progressive Alignment Method on the following 5 sequences and findthe best multiple sequence alignments.Sequence # 1: ATCCAATTTTSequence # 2: ACTGACCSequence # 3: ATGGCCATTSequence # 4: ATCTTCTTSequence # 5: ATTGCCATT
- You wish to align a 300 bp nucleotide sequence to a genome. Which of the following pairwise sequence alignment algorithms is BEST suited for this task? Global alignment or Local alignment? Please explain or elaborate why you chose this alignment algorithm.If you have access to the necessary computer software, make asequence file and analyze it in the following ways: What is thetranslated sequence in all three reading frames? What is the longest open reading frame? Is the sequence homologous to any known sequences? If so, does this provide any clues about the function of the sequence?The plot shows a correlation between sequence error rate and cluster density on an Illumina flow cell. From your knowledge of how Illumina sequencing works, why do you think there is this correlation?