3 Answer questions about the following Purification Tablefor the purification of plasminogen.Table 1Purification of recombinant plasminogen (TAL6003 zymogen) from E coli inclusion bodies.Purification stepProtein concentrationTotal protein(mg)bTotal activity(mg)bCumulativeSpecificactivity(mg/ml)activity yield (%)*bSolubilized inclusion bodies (26 g)Refolded TAL6003 zymogen(Post-refold filtrate TAL6003 zymogen)(Diafiltration retentate TAL6003 zymogen)(Pre-SP Sepharose filtrate TAL6003 zymogen)SP Sepharose eluate TAL6003 zymogenECH Lysine eluate TAL6003 zymogen8.884,4915,2050.511,7431,7301,5421,3790.34 :0.384,3540.363,4113,3131,2821,1840.49 :0.330.42:2.316.201,2701,1950.99 :1.011When proteins are solubilizeain inclusion bodies from anE Coli cell lysate, they are unfolded. How do we knowfrom this purification table that the plasminogen has beenrefolded to its natural (native) state?[ Select ]Which step of the purification enhances the purity of theprotein the most? [ Select ]What is the percent yield of plasminogen for the entirepurification? [ Select] When proteins are solubilized in inclusion bodies from anE Coli cell lysate, they are unfolded. How do we knowfrom this purification table that the plasminogen has beenrefolded to its natural (native) state?[ Select ]Which step of the purification enhances the purity of theprotein the most? [ Select]What is the percent yield of asminogen for the entirepurification? [ Select]What is the fold purification for the entire purificationprocedure [Select ]

Plasminogen is an important enzyme which is present in blood and degrades plasma proteins like…

Answered: Sm When proteins are solubilized in…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Please answer only questions 5-10, thank you GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; Journal Name; Volume; Page Numbers) for a recent publication involving the identified gene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebrate homolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL…
PDB code 7BSJ Questions Q1 - What is the name of the protein Q2 - What does the protein do? Q3 - What are the structural features of the protein? Q4 - What are two features of your protein’s structure that make it different OR similar to haemoglobin? Q5 - Based on the structural properties of your protein, how resistant (or sensitive) would your protein be to heat denaturation and why?
topic: Bradford AssayThere are numerous methods of protein determination in use, but this module focuses on the Bradford assay.The Bradford assay is a dye-binding method that employs Coomassie Brilliant Blue G-250, whose structureis shown in Figure 2.3.4.1. Coomassie Brilliant Blue G-250 is a dye that interacts with proteins throughhydrophobic and electrostatic interactions. What are the identities and functions of the components of the Bradford reagent in protein contentdetermination?
Please answer all questions GTTTTCACTGGCGAGCGTCATCTTCCTACT 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; Journal Name; Volume; Page Numbers) for a recent publication involving the identified gene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebrate homolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the identified putative protein products with at least one similar invertebrate protein (if there is none, use a vertebrate homolog).10. Generate a secondary structure prediction for one identified protein.
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
Briefly compare the composition of DNA versus that of RNA. Answer the following questions pertaining to the experimental use of green fluorescent protein (GFP). What is the main advantage of GFP in terms of protein visualization in cells/organisms? Which microscope technique is used to visualize GFP-tagged proteins?
Please answer ASAP: What is Shine-Dalgarno sequence? In which groups of microorganisms it is found?
Question with regards to SDS-PAG You are working with a unique protein that has no basic amino acids and contains a lot of acidic amino acids. You run a SDS-PAGE gel, you stain and destain it. You get nice bands for your ladder but no bands for your sample proteins. After doing an immunoblot specific for your protein (using the SDS-PAGE gel), you do get a band identifying your protein. You know that your concentration of the protein is sufficient to be visualized by staining it. The immunoblot clearly identifies that your protein is in your gel, why can you not see it after staining and destaining the gel?
Plz choose all correct option and Do explain. Which of the following descriptions about tandem affinity purification is not correct? a.The interaction between calmodulin-binding peptides and calmodulin beads can be broken by adding EDT b.In the first round of elution, TEV protease cleaves the cleavage site on the TAP-fused target protein. c.It enables the purification of protein complexes composed of multiple protein components. d.It is possible to perform two rounds of purification using a single TAP tag. e.The protein A tag binds to beads that have lgG attached to them.
Throughout downstream processing, various analytical methods must be used to evaluate the effectiveness of unit operations. Provide a method or methods (if more than one is required) for each scenario. Assess total protein in rice flour (solid material). Visualize antibody fragments (heavy chain and light chain) and compare molecular weights. Quick determination of the concentration of a purified sample of monoclonal antibody. Determine the concentration of monoclonal antibody in clarified extract. Study aggregation of a protein product without disruption of tertiary protein structure. Characterize phenolics (secondary metabolites and impurities produced by green plant tissue) by identifying phenolic species and relative concentrations. Detect protein variants that differ by a substitution of two amino acids. Quantify the level of endotoxin in the final purified product. Quantify bacterial contamination in your final formulated product.
For the following sequence, what is the approximate annealing temperature? 5'-AGCTACGATCAGGTCA-3'
What is the method of MS protein quantification presented here? Please answer very soon will give rating surely Complete Answer needed

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS

Sm When proteins are solubilized in inclusion bodies from an E Coli cell lysate, they are unfolded. How do we know from this purification table that the plasminogen has been refolded to its natural (native) state? [Select]