GENETIC ANALYSIS & MOD MAST GENETICS
3rd Edition
ISBN: 9780135218754
Author: Sanders
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 1, Problem 29P
Consider the following segment of DNA:
5’-…ATGCCAGTCACTCACTTG…-3’
3’-…TACGGTCAGTGAGTGAAC…-5’
How many phosphodiester bonds are required to form this segment of double-stranded DNA?
How many hydrogen bonds are present in this DNA segment?
If the lower strand of DNA serves as the template transcribed into mRNA, how many peptide bonds are present in the polypeptide fragment into which the mRNA is translated?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’
a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence?
b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence?
c) What would be the other strand of DNA?
The template strand of a segment of double-helical DNA contains the sequence –
5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’
a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends.
b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends.
c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?
The template strand of a double helical segment of DNA consists of the following sequence:
5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’
What is the nucleotide order in the complementary DNA strand?
Chapter 1 Solutions
GENETIC ANALYSIS & MOD MAST GENETICS
Ch. 1 - 1. Genetics affects many aspects of our lives....Ch. 1 - 2. How do you think the determination that DNA is...Ch. 1 - 3. A commentator once described genetics as “the...Ch. 1 - All life shares DNA as the hereditary material....Ch. 1 - Define the terms allele, chromosome, and gene and...Ch. 1 - 6. Define the terms genotype and phenotype, and...Ch. 1 - 7. Define natural selection, and describe how...Ch. 1 - Describe the modern synthesis of evolution, and...Ch. 1 - What are the four processes of evolution? Briefly...Ch. 1 - Define each of the following terms: a....
Ch. 1 - 11. Compare and contrast the genome, the proteome,...Ch. 1 - With respect to transcription describe the...Ch. 1 - Plant agriculture and animal domestication...Ch. 1 - Briefly describe the contribution each of the...Ch. 1 - If thymine makes up 21% of the DNA nucleotides in...Ch. 1 - What reactive chemical groups are found at the 5...Ch. 1 - Identify two differences in chemical composition...Ch. 1 - What is the central dogma of molecular biology?...Ch. 1 - A portion of a polypeptide contains the amino...Ch. 1 - The following segment of DNA is the template...Ch. 1 - 23. Fill in the missing nucleotides (so there are...Ch. 1 - 24. Suppose a genotype for a protein-producing...Ch. 1 - Prob. 25PCh. 1 - 26. Four nucleic acid samples are analyzed to...Ch. 1 - 27. What is meant by the term homology? How is...Ch. 1 - 28. If one is constructing a phylogeny of reptiles...Ch. 1 - 29. Consider the following segment of...Ch. 1 - 30. Ethical and social issues have become a large...Ch. 1 - 31. In certain cases, genetic testing can identify...Ch. 1 - 32. What information presented in this chapter and...Ch. 1 - 33. It is common to study the biology and genetics...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.arrow_forwardWhich of the following single stranded DNA oligonucleotides alone would be expected to spontaneously form linear double stranded DNA molecules? A) 5'-ACGTTGCA-3' B) 5'-GGGGGGGC-3' C) 3'-GTCCCTAT-5 D) 3-CTAATTAG-5' asap pleasearrow_forwardWhich of the following strands of DNA (assuming it was bound to its complementary strand to create a double-helix structure) would be the least difficult to break apart? a. 5' - CCGCCGGCATATCCGAT - 3' b. 5' - CCGCGCGATCGGCGCGT - 3' c. 5' - AATGAGGCCAATTGACA - 3' d. 5' - CCACCAGGCACAGCCGA - 3' e. 5' - AAATTGATATATAGGCA - 3'arrow_forward
- A portion of one strand of DNA has the sequence 5′ AATGGCTTA 3′. If this strand is used as a template for DNA replication, which of the following correctly depicts the sequence of the newly synthesized strand in the direction in which it will be synthesized? 5′ TAAGCCATT 3′ 5′ TTACCGAAT 3′ 3′ AATGGCTTA 5′ 3′ TTACCGAAT 5′ 5′ AATGGCTTA 3′arrow_forwardGive the sequence of the complementary DNA strand for the DNA chain with the following base sequence5'-CTTGGATATC-3'arrow_forwardin DNA replication, if the template strand is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the newly synthesized DNA strand? Write the sequence from 5’ to 3’.arrow_forward
- If one DNA strand has the nucleotide sequence below, what is the nucleotide sequence on its complementary strand? 5’ACCGATTACGATTACG3’ If the template DNA strand has the nucleotide sequence below, what is the nucleotide sequence on mRNA? 5’ACCGATTACGATTACG3’ In the chart below, indicate the unique structural or functional characteristics of DNA and RNA, as well as their similarities. Be very specific. Unique DNA characteristics Similar characteristics Unique RNA characteristicsarrow_forwardGive the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’arrow_forwardConsider a portion of a gene in a cell with the sequence TTTTT. Which of the following bases would you find in the complementary RNA strand, and where in the (eukaryotic) cell would this RNA be synthesized? A) A-A-A-A-A; ribosome B) U-U-U-U-U; ribosome C) A-A-A-A-A; nucleus D) U-U-U-U-U; nucleusarrow_forward
- A DNA strand has the following sequence: 5’-GAACCCGATGGCGATACATTTACCAGATCACCAGC-3’ In which direction would DNA polymerase slide along this strand (from left to right or from right to left)? If this strand was used as a template by DNA polymerase, what would be the sequence of the newly made strand? Indicate the 5’ and 3’ ends of the newly made strand.arrow_forwardThe following DNA sequence is found on a chromosome in rice plants: 5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ What is the amino acid sequence of the longest protein that could be made from this stretch of DNA, assuming that this strand of DNA is the non-template strand? (Remember that the start of translation requires the sequence AUG in the mRNA and “STOP” is not an amino acid.)arrow_forwardThe template strand of a double helical segment of DNA consists of the following sequence: 5’- GTAGCCTTATCTAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACCATGTATAGTTG-3’ Use the given data to answer the succeeding questions and always indicate (and pay attention to) the DIRECTIONALITY of the strands in your answers. Part I. What is the nucleotide order in the complementary DNA strand? Part 2. What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? Part 3. What will be the overall anticodon sequence in tRNA? Part 4. Following the transitional process, what is the amino acid sequence that will be coded for? Show your answer using ONE-letter amino code starting from N-terminus to C-terminus Part 5. Following translational process, what is the amino acid sequence that will be coded for? Show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY