Campbell Biology & Modified Mastering Biology /eText ValuePack Access Card Package
Campbell Biology & Modified Mastering Biology /eText ValuePack Access Card Package
1st Edition
ISBN: 9780133857108
Author: Jane B. Reece, Martha R. Taylor, Eric J. Simon, Jean L. Dickey, Kelly A. Hogan
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 10, Problem 10TYK

The base sequence of the gene coding for a short polypeptide is CTACGCTAGGCGATTGACT. What would be the base sequence of the mRNA transcribed from this gene? Using the genetic code in Figure 10.8A, give the amino acid sequence of the polypeptide translated from this mRNA. (Hint: What is the start codon?)

Blurred answer
Students have asked these similar questions
If the mRNA transcribed for this gene will be translated into a functional protein, how many amino acids will be used to build the polypeptide chain? what is the amino acid coded by the 25th codon? what is the amino acid coded by the last codon?
The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What would be the base sequence of the mRNA transcribed from this gene?   The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. From your answer to the last question, answer this  Using the genetic code, give the amino acid sequence of the polypeptide translated from this mRNA.  Use the three-letter abbrebviation of the amino acid and start with the start codon and stop in the stop codon.
An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon, what is the third amino acid of the translated polypeptide?
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY