Campbell Biology: Conc. and Conn. - Access
8th Edition
ISBN: 9780321946850
Author: Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 10, Problem 10TYK
The base sequence of the gene coding for a short polypeptide is CTACGCTAGGCGATTGACT. What would be the base sequence of the mRNA transcribed from this gene? Using the genetic code in Figure 10.8A, give the amino acid sequence of the polypeptide translated from this mRNA. (Hint: What is the start codon?)
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
If the mRNA transcribed for this gene will be translated into a functional protein,
how many amino acids will be used to build the polypeptide chain?
what is the amino acid coded by the 25th codon?
what is the amino acid coded by the last codon?
The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What would be the base sequence of the mRNA transcribed from this gene?
The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. From your answer to the last question, answer this
Using the genetic code, give the amino acid sequence of the polypeptide translated from this mRNA.
Use the three-letter abbrebviation of the amino acid and start with the start codon and stop in the stop codon.
An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon, what is the third amino acid of the translated polypeptide?
Chapter 10 Solutions
Campbell Biology: Conc. and Conn. - Access
Ch. 10 - Check your understanding of the flow of genetic...Ch. 10 - Which of the following correctly ranks the...Ch. 10 - Describe the process of DNA replication: the...Ch. 10 - What is the name of the process that produces RNA...Ch. 10 - Scientists have discovered how to put together a...Ch. 10 - A geneticist found that a particular mutation had...Ch. 10 - Describe the process by which the information in a...Ch. 10 - The nucleotide sequence of a DNA codon is GTA. A...Ch. 10 - A cell containing a single chromosome is placed in...Ch. 10 - The base sequence of the gene coding for a short...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In the gene-coding sequence shown here, which of the following events will produce a frameshift after the last mutational site? a. insertion of an A after the first codon b. deletion of the second codon (AAA) c. insertion of TA after the second codon and deletion of CG in the fourth codon d. deletion of AC in the third codonarrow_forwardIf the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. fivearrow_forwardGiven the following mRNA sequence, what is the amino acid sequence of the polypeptide that will be produced in the cell? 5’ – CGAGGUAUGCCAACGUGCGUCUAAUCCCGA-3arrow_forward
- An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.arrow_forwardAn mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.arrow_forwardThe following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?arrow_forward
- An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that would be translated from this mRNA.arrow_forwardThe following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’arrow_forwardWhat happens when one base pair of DNA is lost from the coding region of a gene because of mutation? First explain how this would affect the mRNA sequence, and second, explain how this would alter the amino acid of the protein that is encoded.arrow_forward
- The fourth codon in an mRNA sequence is GGG, which specifies glycine. If we assume that no amino acids are removed from the polypeptide, which of the following statements is correct? a. The third amino acid from the N-terminus is glycine. b. The fourth amino acid from the N-terminus is glycine. c. The third amino acid from the C-terminus is glycine. d. The fourth amino acid from the C-terminus is glycine.arrow_forwardAs shown in the following diagram, a pre-mRNA contains seven exons, which are numbered in black, and six introns, which are numbered in green. A splicing repressor binds at the 3′ splice site at the end of intron 4, which is just before exon 5. What exons will be included in the mature mRNA?arrow_forwardHow many amino acids will the mRNA sequence "AUG GAC CUG UCG UGA" produce?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY