STARTING OUT C++,+MATLAB+MYPROGRAMLAB>C
19th Edition
ISBN: 9781323948637
Author: GADDIS
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Question
Chapter 10, Problem 11PC
Program Plan Intro
Case Manipulator
- Include the required header files to the program.
- Declare the constant variable.
- Declare function prototypes which are used in the program.
- Define the “main()” function.
- Declare the required variables.
- Get the input C-string from the user.
- Copy the string 1 to string 2 and string 3.
- Call the “upper” function and display the result.
- Call the “lower” function and display the result.
- Call the “reserve” function and display the result.
- Define the “upper” function.
- Check the string not equal to zero.
- If the letter is not an uppercase, change the letters into uppercase using “toupper” function.
- Check the string not equal to zero.
- Define the “lower” function.
- Check the string not equal to zero.
- If the letter is not a lowercase, change the letters into lowercase using “tolower” function.
- Check the string not equal to zero.
- Define the “reverse” function.
- Check the string not equal to zero.
- If the letter is not an uppercase, change the letters into uppercase using “toupper” function.
- Otherwise, if the letter is not a lowercase, change the letters into lowercase using “tolower” function.
- Check the string not equal to zero.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
In C++,
Write a function that receives a string of characters and return true if the string is in language, otherwise it returns false. You may use following function header (Assume a string is in language if it is read from the left side is the same as it is read from the right side. For example, a-b-d-c is not in the language, a-b-c-a-c-b-a is in language):
bool isInLanguage_2(string aString)
And I also, want to know if my if statement is incorrect, and if it is how is it incorrect?
C++ Code: DNA Sequence
The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence.
For example,
if input sequence is:
AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA
then
numOccurrences("AGAT", sequence) should return 5
numOccurrences("TATC", sequence) should return 8
if input sequence is:
AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG
then
numOccurrences("AATG", sequence) should return 7
numOccurrences("TATC", sequence) should return 4
if input sequence is:…
String Manipulation
In this question, you will be implementing the following functions
int findChar(char * str, char c);
Searches for the character c in the string str and returns the index of the character in the string. If the character does not exist, returns -1
int replaceChar(char * str, char c1, char c2);
Searches for the character c1 in the string str and if found, replace it with c2.The function returns the number of replacements it has performed. If the character does not exist, returns 0.
int removeChar(char * str1, char * str2, char c);
Creates a copy of str1 into str2 except for the character c that should be replaced with ‘*’
For example, if
str1=”Hello World” and
c=’l’ then the function should make
str2=”He**o Wor*d”
int isPalindrome(char * str)
Checks to see if a string is Palindrome(reversible). If it is, returns 1, otherwise returns 0. A palindrome string reads similarly from left to right and from right to left like madam, level, radar, etc.
int reverseString(char…
Chapter 10 Solutions
STARTING OUT C++,+MATLAB+MYPROGRAMLAB>C
Ch. 10.2 - Write a short description of each of the following...Ch. 10.2 - Prob. 10.2CPCh. 10.2 - Write an if statement that will display the word...Ch. 10.2 - What is the output of the following statement?...Ch. 10.2 - Write a loop that asks the user Do you want to...Ch. 10.4 - Write a short description of each of the following...Ch. 10.4 - Prob. 10.7CPCh. 10.4 - Prob. 10.8CPCh. 10.4 - Prob. 10.9CPCh. 10.4 - When complete, the following program skeleton will...
Ch. 10.5 - Write a short description of each of the following...Ch. 10.5 - Write a statement that will convert the string 10...Ch. 10.5 - Prob. 10.13CPCh. 10.5 - Write a statement that will convert the string...Ch. 10.5 - Write a statement that will convert the integer...Ch. 10.6 - Prob. 10.16CPCh. 10 - Prob. 1RQECh. 10 - Prob. 2RQECh. 10 - Prob. 3RQECh. 10 - Prob. 4RQECh. 10 - Prob. 5RQECh. 10 - Prob. 6RQECh. 10 - Prob. 7RQECh. 10 - Prob. 8RQECh. 10 - Prob. 9RQECh. 10 - Prob. 10RQECh. 10 - The __________ function returns true if the...Ch. 10 - Prob. 12RQECh. 10 - Prob. 13RQECh. 10 - The __________ function returns the lowercase...Ch. 10 - The _________ file must be included in a program...Ch. 10 - Prob. 16RQECh. 10 - Prob. 17RQECh. 10 - Prob. 18RQECh. 10 - Prob. 19RQECh. 10 - Prob. 20RQECh. 10 - Prob. 21RQECh. 10 - Prob. 22RQECh. 10 - Prob. 23RQECh. 10 - Prob. 24RQECh. 10 - The ________ function returns the value of a...Ch. 10 - Prob. 26RQECh. 10 - The following if statement determines whether...Ch. 10 - Assume input is a char array holding a C-string....Ch. 10 - Look at the following array definition: char...Ch. 10 - Prob. 30RQECh. 10 - Write a function that accepts a pointer to a...Ch. 10 - Prob. 32RQECh. 10 - Prob. 33RQECh. 10 - T F If touppers argument is already uppercase, it...Ch. 10 - T F If tolowers argument is already lowercase, it...Ch. 10 - T F The strlen function returns the size of the...Ch. 10 - Prob. 37RQECh. 10 - T F C-string-handling functions accept as...Ch. 10 - T F The strcat function checks to make sure the...Ch. 10 - Prob. 40RQECh. 10 - T F The strcpy function performs no bounds...Ch. 10 - T F There is no difference between 847 and 847.Ch. 10 - Prob. 43RQECh. 10 - char numeric[5]; int x = 123; numeri c = atoi(x);Ch. 10 - char string1[] = "Billy"; char string2[] = " Bob...Ch. 10 - Prob. 46RQECh. 10 - Prob. 1PCCh. 10 - Prob. 2PCCh. 10 - Prob. 3PCCh. 10 - Average Number of Letters Modify the program you...Ch. 10 - Prob. 5PCCh. 10 - Prob. 6PCCh. 10 - Name Arranger Write a program that asks for the...Ch. 10 - Prob. 8PCCh. 10 - Prob. 9PCCh. 10 - Prob. 10PCCh. 10 - Prob. 11PCCh. 10 - Password Verifier Imagine you are developing a...Ch. 10 - Prob. 13PCCh. 10 - Word Separator Write a program that accepts as...Ch. 10 - Character Analysis If you have downloaded this...Ch. 10 - Prob. 16PCCh. 10 - Prob. 17PCCh. 10 - Prob. 18PCCh. 10 - Check Writer Write a program that displays a...
Knowledge Booster
Similar questions
- Computer Science ****Please Write a program CODE in C 2. Write a function which takes a string of any length and returns the number of times the letter a appears in the string. Write the main program, which prompts the user to enter a sentence (up to 100 characters) and uses the function to find the number of times a occurs in the sentence. Print the result.arrow_forwardQuestion Mo Write a function that accepts a pointer to a C-string as its argument. The function should count the number of times the character ‘G’ or the character ‘H’ occurs in the argument and return that number. Full explain this question and text typing work only We should answer our question within 2 hours takes more time then we will reduce Rating Dont ignore this linearrow_forwardQuestion 1: break phrase Problem statement Breaking a string into two parts based on a delimiter has applications. For example, given an email address, breaking it based on the delimiter "@" gives you the two parts, the mail server's domain name and email username. Another example would be separating a phone number into the area code and the rest. Given a phrase of string and a delimiter string (shorter than the phrase but may be longer than length 1), write a C++ function named break_string to break the phrase into two parts and return the parts as a C++ std::pair object (left part goes to the "first" and right part goes to the "second"). Do the following Write your algorithm as code comments. I recommend to follow UMPIRE technique Implement your functionarrow_forward
- Create a function called reverse() that has a string parameter. The function reverses the characters of the string locally. ( in C language)arrow_forwardC code blocks Implement a function which receives a character array and determines if the word is a palindrome or not. A palindrome is a string that is spelt the same way forwards and backwards (see the example below). The function should return 1 if the character array is a palindrome and 0 if it is not. Write the entire function in the space below. Your answer should not include the function prototype, the main function or any include statements. The function should not contain any printf statements. Define your function in the same way as the given function prototype. Function prototype: int palindrome(char a[]); For example: Input Result hello 0 radar 1 acca 1arrow_forward8.10 (Appending Part of a String) Write a program that uses function strncat to append part of a string to another string. The program should input the strings, and the number of characters to be appended, then display the first string and its length after the second string was appended. **Note solve question without using pointers in c languagearrow_forward
- Complete the check_character() function which has 2 parameters: A string, and a specified index. The function checks the character at the specified index of the string parameter, and returns a string based on the type of character at that location indicating if the character is a letter, digit, whitespace, or unknown character. Ex: The function calls below with the given arguments will return the following strings: check_character('happy birthday', 2) returns "Character 'p' is a letter"check_character('happy birthday', 5) returns "Character ' ' is a white space"check_character('happy birthday 2 you', 15) returns "Character '2' is a digit"check_character('happy birthday!', 14) returns "Character '!' is unknown" use python please def check_character(word, index): # Type your code here. if __name__ == '__main__': print(check_character('happy birthday', 2)) print(check_character('happy birthday', 5)) print(check_character('happy birthday 2 you', 15))…arrow_forwardWrite a C++ program using C-Strings 4. This function returns the index in string s where the substring can first be found. For example if s is “Skyscraper” and substring is “ysc” the function would return 2. It should return -1 if the substring does not appear in the string. int findSubstring(char *s, char substring[]) 5. This function returns true if the argument string is a palindrome. It returns false if it is not. A palindrome is a string that is spelled the same as its reverse. For example “abba” is a palindrome. So is “hannah”, “abc cba”, and “radar”. bool isPalindrome(char *s) Note: do not get confused by white space characters. They should not get any special treatment. “abc ba” is not a palindrome. It is not identical to its reverse. 6) This function should reverse the words in a string. A word can be considered to be any characters, including punctuation, separated by spaces (only spaces, not tabs, \n etc.). So, for example, if s is “The Giants won the Pennant!”…arrow_forwardWrite a C function called stringCopy(destination, source). This function takes two C strings as parameters and copies the source string into the destination string. Once the copy is completed, the function returns the number of characters (except null) that were copied. You cannot use the C library functions strcpy, strcat or any of their variants. You need to write all the code required to do the copy yourself. However, you may use a C library function to determine the length of a string. b. What is the important precondition for stringCopy to work? Explain why the precondition is necessary. c. Write a C main program to demonstrate/test that your stringCopyfunction works. You will need the program to read user input into the source string.arrow_forward
- Write a C function called stringCopy(destination, source). This function takes two C strings as parameters and copies the source string into the destination string. Once the copy is completed, the function returns the number of characters (except null) that were copied. You cannot use the C library functions strcpy, strcat or any of their variants. You need to write all the code required to do the copy yourself. However, you may use a C library function to determine the length of a string.arrow_forward21.1 LAB: Fun with characters Complete the check_character() function which has 2 parameters: A string, and a specified index. The function checks the character at the specified index of the string parameter, and returns a string based on the type of character at that location indicating if the character is a letter, digit, whitespace, or unknown character. Ex: The function calls below with the given arguments will return the following strings: check_character('happy birthday', 2) returns "Character 'p' is a letter"check_character('happy birthday', 5) returns "Character ' ' is a white space"check_character('happy birthday 2 you', 15) returns "Character '2' is a digit"check_character('happy birthday!', 14) returns "Character '!' is unknown" Use Python, please.arrow_forwardin c programing with User-Defined Functions Remove all non-alphabetic characters Write a program that removes all non-alphabetic characters from the given input. Assume the input string will not exceed 50 characters. Ex: If the input is: -Hello, 1 world$! the output is: Helloworld The program must define and call a function named RemoveNonAlpha that takes two strings as parameters: userString and userStringAlphaOnly. userString is the user specified string from the program input. Function RemoveNonAlpha() then assigns userStringAlphaOnly with the user specified string without any non-alphabetic characters.void RemoveNonAlpha(char userString[], char userStringAlphaOnly[])arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- C++ Programming: From Problem Analysis to Program...Computer ScienceISBN:9781337102087Author:D. S. MalikPublisher:Cengage Learning
C++ Programming: From Problem Analysis to Program...
Computer Science
ISBN:9781337102087
Author:D. S. Malik
Publisher:Cengage Learning