STARTING OUT C++,+MATLAB+MYPROGRAMLAB>C
19th Edition
ISBN: 9781323948637
Author: GADDIS
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Question
Chapter 10, Problem 1PC
Program Plan Intro
String Length
- Include the required header files to the program.
- Declare function prototype which is used in the program.
- Define the “main()” function.
- Declare the required variables.
- Get the input string from the user and call the function “string_length”.
- Define the “string_length” function.
- Declare the variable.
- The “while” loop is used to check the length of the string.
- Finally return the length of the string to the main function.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
IN C Programming Language...THANKS
Write a function that replaces a given string with ‘*’ within a given text if that string is a full word, or the beginning or end of a word. Test your function with a suitable main.
Computer Science
****Please Write a program CODE in C
2. Write a function which takes a string of any length and returns the number of times the
letter a appears in the string.
Write the main program, which prompts the user to enter a sentence (up to 100
characters) and uses the function to find the number of times a occurs in the sentence.
Print the result.
(C++) 9. True/False: the strcpy() function will make sure there is enough memory allocated in the destination string before copying C-strings
10. True/False: when creating a string object, you must dynamically allocate enough bytes to hold the string
11. Consider the following statement, assuming goAgain is a valid char. Rewrite it using toupper() or tolower()
if (goAgain == 'y' || goAgain == 'Y')
12. Write a C++ function which accepts a pointer to a C-string as its argument. It should return the number of words in the C-string. For example, for the C-string “The Giants won the pennant!” your function should return 5. You may assume the parameter passed is a pointer to a valid, null-terminated C-string with no newlines or tabs, exactly one space separates each word, and there is at least one word.
int wordCounter(char* str)
Chapter 10 Solutions
STARTING OUT C++,+MATLAB+MYPROGRAMLAB>C
Ch. 10.2 - Write a short description of each of the following...Ch. 10.2 - Prob. 10.2CPCh. 10.2 - Write an if statement that will display the word...Ch. 10.2 - What is the output of the following statement?...Ch. 10.2 - Write a loop that asks the user Do you want to...Ch. 10.4 - Write a short description of each of the following...Ch. 10.4 - Prob. 10.7CPCh. 10.4 - Prob. 10.8CPCh. 10.4 - Prob. 10.9CPCh. 10.4 - When complete, the following program skeleton will...
Ch. 10.5 - Write a short description of each of the following...Ch. 10.5 - Write a statement that will convert the string 10...Ch. 10.5 - Prob. 10.13CPCh. 10.5 - Write a statement that will convert the string...Ch. 10.5 - Write a statement that will convert the integer...Ch. 10.6 - Prob. 10.16CPCh. 10 - Prob. 1RQECh. 10 - Prob. 2RQECh. 10 - Prob. 3RQECh. 10 - Prob. 4RQECh. 10 - Prob. 5RQECh. 10 - Prob. 6RQECh. 10 - Prob. 7RQECh. 10 - Prob. 8RQECh. 10 - Prob. 9RQECh. 10 - Prob. 10RQECh. 10 - The __________ function returns true if the...Ch. 10 - Prob. 12RQECh. 10 - Prob. 13RQECh. 10 - The __________ function returns the lowercase...Ch. 10 - The _________ file must be included in a program...Ch. 10 - Prob. 16RQECh. 10 - Prob. 17RQECh. 10 - Prob. 18RQECh. 10 - Prob. 19RQECh. 10 - Prob. 20RQECh. 10 - Prob. 21RQECh. 10 - Prob. 22RQECh. 10 - Prob. 23RQECh. 10 - Prob. 24RQECh. 10 - The ________ function returns the value of a...Ch. 10 - Prob. 26RQECh. 10 - The following if statement determines whether...Ch. 10 - Assume input is a char array holding a C-string....Ch. 10 - Look at the following array definition: char...Ch. 10 - Prob. 30RQECh. 10 - Write a function that accepts a pointer to a...Ch. 10 - Prob. 32RQECh. 10 - Prob. 33RQECh. 10 - T F If touppers argument is already uppercase, it...Ch. 10 - T F If tolowers argument is already lowercase, it...Ch. 10 - T F The strlen function returns the size of the...Ch. 10 - Prob. 37RQECh. 10 - T F C-string-handling functions accept as...Ch. 10 - T F The strcat function checks to make sure the...Ch. 10 - Prob. 40RQECh. 10 - T F The strcpy function performs no bounds...Ch. 10 - T F There is no difference between 847 and 847.Ch. 10 - Prob. 43RQECh. 10 - char numeric[5]; int x = 123; numeri c = atoi(x);Ch. 10 - char string1[] = "Billy"; char string2[] = " Bob...Ch. 10 - Prob. 46RQECh. 10 - Prob. 1PCCh. 10 - Prob. 2PCCh. 10 - Prob. 3PCCh. 10 - Average Number of Letters Modify the program you...Ch. 10 - Prob. 5PCCh. 10 - Prob. 6PCCh. 10 - Name Arranger Write a program that asks for the...Ch. 10 - Prob. 8PCCh. 10 - Prob. 9PCCh. 10 - Prob. 10PCCh. 10 - Prob. 11PCCh. 10 - Password Verifier Imagine you are developing a...Ch. 10 - Prob. 13PCCh. 10 - Word Separator Write a program that accepts as...Ch. 10 - Character Analysis If you have downloaded this...Ch. 10 - Prob. 16PCCh. 10 - Prob. 17PCCh. 10 - Prob. 18PCCh. 10 - Check Writer Write a program that displays a...
Knowledge Booster
Similar questions
- Python language. Write a function that return multiple value of string type. You have to print those in main function. Hint : - you can use dictionaryarrow_forwardpython3 program : Write a function that removes all spaces from a given string string and returns the new string.arrow_forwardPlease Help C++ Write a function that returns an integer and accepts a pointer to a C-string as an argument. The function should count the number of characters in the string and return that number. Demonstrate the function in a simple program that asks the user to input a string, passes it to the function, and then displays the function’s return value.arrow_forward
- C++ Code: DNA Sequence The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence. For example, if input sequence is: AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA then numOccurrences("AGAT", sequence) should return 5 numOccurrences("TATC", sequence) should return 8 if input sequence is: AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG then numOccurrences("AATG", sequence) should return 7 numOccurrences("TATC", sequence) should return 4 if input sequence is:…arrow_forwardWrite a C++ program using C-Strings 4. This function returns the index in string s where the substring can first be found. For example if s is “Skyscraper” and substring is “ysc” the function would return 2. It should return -1 if the substring does not appear in the string. int findSubstring(char *s, char substring[]) 5. This function returns true if the argument string is a palindrome. It returns false if it is not. A palindrome is a string that is spelled the same as its reverse. For example “abba” is a palindrome. So is “hannah”, “abc cba”, and “radar”. bool isPalindrome(char *s) Note: do not get confused by white space characters. They should not get any special treatment. “abc ba” is not a palindrome. It is not identical to its reverse. 6) This function should reverse the words in a string. A word can be considered to be any characters, including punctuation, separated by spaces (only spaces, not tabs, \n etc.). So, for example, if s is “The Giants won the Pennant!”…arrow_forwardString Manipulation In this question, you will be implementing the following functions int findChar(char * str, char c); Searches for the character c in the string str and returns the index of the character in the string. If the character does not exist, returns -1 int replaceChar(char * str, char c1, char c2); Searches for the character c1 in the string str and if found, replace it with c2.The function returns the number of replacements it has performed. If the character does not exist, returns 0. int removeChar(char * str1, char * str2, char c); Creates a copy of str1 into str2 except for the character c that should be replaced with ‘*’ For example, if str1=”Hello World” and c=’l’ then the function should make str2=”He**o Wor*d” int isPalindrome(char * str) Checks to see if a string is Palindrome(reversible). If it is, returns 1, otherwise returns 0. A palindrome string reads similarly from left to right and from right to left like madam, level, radar, etc. int reverseString(char…arrow_forward
- Pointer Arithmetic Write a program that accepts a string and print the reversed form of that string using a pointer ptr. Input: One line Containing String Sample Output: Enter a string: Test tseTarrow_forwardC++ Write a program that first asks the user to enter a string and then asks the user to enter a character. The program should display the number of times the character appears in the string. Use the function Count_char(). A function Count_char() that has two arguments. The first argument is an array and the second argument is a character. The function returns an integer.arrow_forward(C++) The _____ function can append a C-String to another C-String. A) strcat() B) atoi() C) strlen() D) strcpy()arrow_forward
- Write a C function called stringCopy(destination, source). This function takes two C strings as parameters and copies the source string into the destination string. Once the copy is completed, the function returns the number of characters (except null) that were copied. You cannot use the C library functions strcpy, strcat or any of their variants. You need to write all the code required to do the copy yourself. However, you may use a C library function to determine the length of a string.arrow_forwardIN C PROGRAMMING LANGUAGE PLEASE AND COMMENT EVERY LINE PLEASE SO I CAN UNDERSTAND Write your own code in the form of a function that split a string of words separated by spaces into these words. The program should print each word per a new line.arrow_forwardWrite a C function called stringCopy(destination, source). This function takes two C strings as parameters and copies the source string into the destination string. Once the copy is completed, the function returns the number of characters (except null) that were copied. You cannot use the C library functions strcpy, strcat or any of their variants. You need to write all the code required to do the copy yourself. However, you may use a C library function to determine the length of a string. b. What is the important precondition for stringCopy to work? Explain why the precondition is necessary. c. Write a C main program to demonstrate/test that your stringCopyfunction works. You will need the program to read user input into the source string.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- C++ Programming: From Problem Analysis to Program...Computer ScienceISBN:9781337102087Author:D. S. MalikPublisher:Cengage LearningC++ for Engineers and ScientistsComputer ScienceISBN:9781133187844Author:Bronson, Gary J.Publisher:Course Technology Ptr
C++ Programming: From Problem Analysis to Program...
Computer Science
ISBN:9781337102087
Author:D. S. Malik
Publisher:Cengage Learning
C++ for Engineers and Scientists
Computer Science
ISBN:9781133187844
Author:Bronson, Gary J.
Publisher:Course Technology Ptr