STARTING OUT C++,+MATLAB+MYPROGRAMLAB>C
19th Edition
ISBN: 9781323948637
Author: GADDIS
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Question
Chapter 10, Problem 6PC
Program Plan Intro
Vowels and Consonants
- Include the required header files to the program.
- Declare function prototype which is used in the program.
- Define the “main()” function.
- Declare the required variables.
- Get the input c-string from the user and display the menu.
- Validate the user option.
- Switch-case statement is used to call the function according to user option and display the result.
- Define the “vowels” function.
- Declare the variables.
- The “while” loop is used to count the total number of vowels in the sentence.
- Return the result to the main function.
- Define the “consonants” function.
- Declare the variables.
- The “while” loop is used to count the total number of consonants in the sentence.
- Return the result to the main function.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Question Mo
Write a function that accepts a pointer to a C-string as its argument. The function should count the number of times the character ‘G’ or the character ‘H’ occurs in the argument and return that number.
Full explain this question and text typing work only We should answer our question within 2 hours takes more time then we will reduce Rating Dont ignore this line
Computer Science
****Please Write a program CODE in C
2. Write a function which takes a string of any length and returns the number of times the
letter a appears in the string.
Write the main program, which prompts the user to enter a sentence (up to 100
characters) and uses the function to find the number of times a occurs in the sentence.
Print the result.
Complete the check_character() function which has 2 parameters: A string, and a specified index. The function checks the character at the specified index of the string parameter, and returns a string based on the type of character at that location indicating if the character is a letter, digit, whitespace, or unknown character.
Ex: The function calls below with the given arguments will return the following strings:
check_character('happy birthday', 2) returns "Character 'p' is a letter"check_character('happy birthday', 5) returns "Character ' ' is a white space"check_character('happy birthday 2 you', 15) returns "Character '2' is a digit"check_character('happy birthday!', 14) returns "Character '!' is unknown"
use python please
def check_character(word, index): # Type your code here. if __name__ == '__main__': print(check_character('happy birthday', 2)) print(check_character('happy birthday', 5)) print(check_character('happy birthday 2 you', 15))…
Chapter 10 Solutions
STARTING OUT C++,+MATLAB+MYPROGRAMLAB>C
Ch. 10.2 - Write a short description of each of the following...Ch. 10.2 - Prob. 10.2CPCh. 10.2 - Write an if statement that will display the word...Ch. 10.2 - What is the output of the following statement?...Ch. 10.2 - Write a loop that asks the user Do you want to...Ch. 10.4 - Write a short description of each of the following...Ch. 10.4 - Prob. 10.7CPCh. 10.4 - Prob. 10.8CPCh. 10.4 - Prob. 10.9CPCh. 10.4 - When complete, the following program skeleton will...
Ch. 10.5 - Write a short description of each of the following...Ch. 10.5 - Write a statement that will convert the string 10...Ch. 10.5 - Prob. 10.13CPCh. 10.5 - Write a statement that will convert the string...Ch. 10.5 - Write a statement that will convert the integer...Ch. 10.6 - Prob. 10.16CPCh. 10 - Prob. 1RQECh. 10 - Prob. 2RQECh. 10 - Prob. 3RQECh. 10 - Prob. 4RQECh. 10 - Prob. 5RQECh. 10 - Prob. 6RQECh. 10 - Prob. 7RQECh. 10 - Prob. 8RQECh. 10 - Prob. 9RQECh. 10 - Prob. 10RQECh. 10 - The __________ function returns true if the...Ch. 10 - Prob. 12RQECh. 10 - Prob. 13RQECh. 10 - The __________ function returns the lowercase...Ch. 10 - The _________ file must be included in a program...Ch. 10 - Prob. 16RQECh. 10 - Prob. 17RQECh. 10 - Prob. 18RQECh. 10 - Prob. 19RQECh. 10 - Prob. 20RQECh. 10 - Prob. 21RQECh. 10 - Prob. 22RQECh. 10 - Prob. 23RQECh. 10 - Prob. 24RQECh. 10 - The ________ function returns the value of a...Ch. 10 - Prob. 26RQECh. 10 - The following if statement determines whether...Ch. 10 - Assume input is a char array holding a C-string....Ch. 10 - Look at the following array definition: char...Ch. 10 - Prob. 30RQECh. 10 - Write a function that accepts a pointer to a...Ch. 10 - Prob. 32RQECh. 10 - Prob. 33RQECh. 10 - T F If touppers argument is already uppercase, it...Ch. 10 - T F If tolowers argument is already lowercase, it...Ch. 10 - T F The strlen function returns the size of the...Ch. 10 - Prob. 37RQECh. 10 - T F C-string-handling functions accept as...Ch. 10 - T F The strcat function checks to make sure the...Ch. 10 - Prob. 40RQECh. 10 - T F The strcpy function performs no bounds...Ch. 10 - T F There is no difference between 847 and 847.Ch. 10 - Prob. 43RQECh. 10 - char numeric[5]; int x = 123; numeri c = atoi(x);Ch. 10 - char string1[] = "Billy"; char string2[] = " Bob...Ch. 10 - Prob. 46RQECh. 10 - Prob. 1PCCh. 10 - Prob. 2PCCh. 10 - Prob. 3PCCh. 10 - Average Number of Letters Modify the program you...Ch. 10 - Prob. 5PCCh. 10 - Prob. 6PCCh. 10 - Name Arranger Write a program that asks for the...Ch. 10 - Prob. 8PCCh. 10 - Prob. 9PCCh. 10 - Prob. 10PCCh. 10 - Prob. 11PCCh. 10 - Password Verifier Imagine you are developing a...Ch. 10 - Prob. 13PCCh. 10 - Word Separator Write a program that accepts as...Ch. 10 - Character Analysis If you have downloaded this...Ch. 10 - Prob. 16PCCh. 10 - Prob. 17PCCh. 10 - Prob. 18PCCh. 10 - Check Writer Write a program that displays a...
Knowledge Booster
Similar questions
- C++ Code Please Write a program that prompts the user to input a string. The program then uses the function substr to remove all the vowels from the string. For example, if str = "There", then after removing all the vowels, str = "Thr". After removing all the vowels, output the string. Your program must contain a function to remove all the vowels and a function to determine whether a character is a vowel.arrow_forward21.1 LAB: Fun with characters Complete the check_character() function which has 2 parameters: A string, and a specified index. The function checks the character at the specified index of the string parameter, and returns a string based on the type of character at that location indicating if the character is a letter, digit, whitespace, or unknown character. Ex: The function calls below with the given arguments will return the following strings: check_character('happy birthday', 2) returns "Character 'p' is a letter"check_character('happy birthday', 5) returns "Character ' ' is a white space"check_character('happy birthday 2 you', 15) returns "Character '2' is a digit"check_character('happy birthday!', 14) returns "Character '!' is unknown" Use Python, please.arrow_forwardPlease Help C++ Write a function that returns an integer and accepts a pointer to a C-string as an argument. The function should count the number of characters in the string and return that number. Demonstrate the function in a simple program that asks the user to input a string, passes it to the function, and then displays the function’s return value.arrow_forward
- Python task You must write a function control (p_nr) that calculates and returns the control digit in a 10-digit social security number if you send in the first 9 digits in the form of a string. The rules for calculating the check digit in a social security number are as follows:The numbers are multiplied alternately by 2 and 1 and then the products are summed. For a two-digit product, the sum of its numbers is calculated. The sum is then subtracted from the nearest higher tens to obtain the check digit.To calculate the check digit for the social security number with the first 9 digits 811218987, perform the following setup: 8 1 1 2 1 8 9 8 7 2 1 2 1 2 1 2 1 2 16 1 2 2 2 8 18 8 141 + 6 + 1 + 2 + 2 + 2 + 8 + 1 + 8 + 8 + 1 + 4 = 44The check digit is 50-44 = 6 # test personal_number = input () control_digit = control(personal_number) print(control_digit)arrow_forwardC++ Code: DNA Sequence The main() function is already written for you. You will implement the function int numOccurrences(string& STR, string& sequence). Without even understanding what functions do in C++, all you need to know, at this point, is that you have access to the string STR of which you have to find the length of the largest consecutive occurrence in the string sequence. For example, if input sequence is: AGACGGGTTACCATGACTATCTATCTATCTATCTATCTATCTATCTATCACGTACGTACGTATCGAGATAGATAGATAGATAGATCCTCGACTTCGATCGCAATGAATGCCAATAGACAAAA then numOccurrences("AGAT", sequence) should return 5 numOccurrences("TATC", sequence) should return 8 if input sequence is: AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG then numOccurrences("AATG", sequence) should return 7 numOccurrences("TATC", sequence) should return 4 if input sequence is:…arrow_forwardWrite a C function called stringCopy(destination, source). This function takes two C strings as parameters and copies the source string into the destination string. Once the copy is completed, the function returns the number of characters (except null) that were copied. You cannot use the C library functions strcpy, strcat or any of their variants. You need to write all the code required to do the copy yourself. However, you may use a C library function to determine the length of a string. b. What is the important precondition for stringCopy to work? Explain why the precondition is necessary. c. Write a C main program to demonstrate/test that your stringCopyfunction works. You will need the program to read user input into the source string.arrow_forward
- 1. Write a function that receives a string of characters as its input, and check if it is symmetric to a dollar sign. You may use following function header: bool isInLanguage_1(string aString) 2. Write a function that receives a string of characters and return true if the string is in language, otherwise it returns false. You may use following function header (Assume a string is in language if it is read from the left side is the same as it is read from the right side. For example, a-b-d-c is not in the language, a-b-c-a-c-b-a is in language): bool isInLanguage_2(string aString) I tried using a while loop, but for some reason, I am not getting the output I was hoping for and would like you to check this out.arrow_forwardWrite a isPalindrome Function Write a function isPalindrome($str) that returns true if the parameter string is a palindrome (a palindrome is a word or sentence that reads the same forward and backward at the character level). You should ignore non-letter characters when determining if the string is a palindrome. Thus, isPalindrome("A man, a plan, a canal, Panama!") should return true.arrow_forwardIn C language / Please don't use (sprint) function. Write a function fact_calc that takes a string output argument and an integer input argument n and returns a string showing the calculation of n!. For example, if the value supplied for n were 6, the string returned would be 6! 5 6 3 5 3 4 3 3 3 2 3 1 5 720 Write a program that repeatedly prompts the user for an integer between 0 and 9, calls fact_calc and outputs the resulting string. If the user inputs an invalid value, the program should display an error message and re-prompt for valid input. Input of the sentinel -1 should cause the input loop to exit. Note: Don't print factorial of -1, or any number that is not between 0 and 9. SAMPLE RUN #4: ./Fact Interactive Session Hide Invisibles Highlight: None Show Highlighted Only Enter·an·integer·between·0·and·9·or·-1·to·quit:5↵ 5!·=·5·x·4·x·3·x·2·x·1·x··=·120↵ Enter·an·integer·between·0·and·9·or·-1·to·quit:6↵ 6!·=·6·x·5·x·4·x·3·x·2·x·1·x··=·720↵…arrow_forward
- Binary to String Create a function binary_to_ascii_string() that converts binary information into ASCII characters. This accepts a list of binaries, binary_values, and returns them as a string. (Note that the binary strings have 8 characters.) An example is present in the photo below. Thank you!arrow_forwardWrite a function findLetter based on the following rules: It takes a string named str and a character named ch as parameter, returns the index of the first occurrence of the character ch if the str string contains the character ch; If the relevant character is not found in the string, write a function that returns -1. Call the function inside the main function and test it. You should use the prototype given below: int findLetter (char str [], char ch)arrow_forwardWhen a function accepts several arguments, how important is it what order those arguments are sent in?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- C++ for Engineers and ScientistsComputer ScienceISBN:9781133187844Author:Bronson, Gary J.Publisher:Course Technology PtrC++ Programming: From Problem Analysis to Program...Computer ScienceISBN:9781337102087Author:D. S. MalikPublisher:Cengage Learning
C++ for Engineers and Scientists
Computer Science
ISBN:9781133187844
Author:Bronson, Gary J.
Publisher:Course Technology Ptr
C++ Programming: From Problem Analysis to Program...
Computer Science
ISBN:9781337102087
Author:D. S. Malik
Publisher:Cengage Learning