Biology: The Unity and Diversity of Life (MindTap Course List)
15th Edition
ISBN: 9781337408332
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 10, Problem 15SQ
Summary Introduction
To match: Each term with their suitable description.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Match the terms with the most suitable description. ___ operon a. makes a man out of you ___ Circadian rhythm b. binding site for repressor ___ Barr body c. can be epigenetic ___ differentiation d. inactivated X chromosome ___ mRNA zip code e. controls multiple genes ___ DNA methylation f. localization mechanism ___ eyeless g. speeds transcription ___ activator h. required for eye formation ___ SRY gene i. effect of regulatory loops ___ operator j. cells become specialized
Mutations to proto-oncogenes act toa. increase cell division. c. repress oncogenes.b. increase DNA repair. d. decrease cell division
A cell is produced with a mutation that causes it produce a completely defective TFIIH. What does this likely mean for the fate of the cell?
A) The cell's copied DNA may contain more errors.
B) the cell cannot make RNA
C) Producing RNAs will be slower because the polymerase will fall off the DNA more often.
D) The cell cannot replicate its DNA
Chapter 10 Solutions
Biology: The Unity and Diversity of Life (MindTap Course List)
Ch. 10 - Effect of Paternal Grandmother's Food Supply on...Ch. 10 - Effect of Paternal Grandmother's Food Supply on...Ch. 10 - Effect of Paternal Grandmother's Food Supply on...Ch. 10 - Gene expression does not vary by ___ . a. cell...Ch. 10 - Binding or ___ to ___ in DNA can increase the rate...Ch. 10 - Muscle cells differ from bone cells because they...Ch. 10 - Prob. 4SQCh. 10 - Mechanisms that govern gene expression do not...Ch. 10 - Prob. 6SQCh. 10 - Prob. 7SQ
Ch. 10 - Prob. 8SQCh. 10 - Which of the following includes all of the others?...Ch. 10 - Prob. 10SQCh. 10 - Prob. 11SQCh. 10 - A cell with a Barr body is ___ . a. a bacterium b....Ch. 10 - Prob. 13SQCh. 10 - Which of the following statements is incorrect? a....Ch. 10 - Prob. 15SQCh. 10 - Explain why somebut not allof an organism's genes...Ch. 10 - Do the same mechanisms that govern gene expression...Ch. 10 - Prob. 3CTCh. 10 - The photos below show flowers from two Arabidopsis...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Match the terms with the most suitable description. ___ methylation a. makes a man out of you ___ SRY gene b. binding site for repressor ___ operator c. cells become specialized ___ Barr body d. can be epigenetic ___ differentiation e. inactivated X chromosomearrow_forwardMutations ________. a. are always bad b. have variable impacts c. are usually beneficialarrow_forwardA tumor suppressor genea. inhibits cell division.b. opposes oncogenes.c. prevents cancer.d. is subject to mutations.e. All of these are correct.arrow_forward
- Stargardt's disease was one of these that can be treated using embryonic stem cells. Why would scientist chose to use this type of stem cell in treatment of Stargard's? A. There ae not ethical issue concerning their use B. They retain stem cell properties even after specialization C. They are able to differentiate into the required cell type D. They are already specialized for this funtionarrow_forwardOf those in the following list, which organ(s)/tissue(s) is/are affected by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? select all that apply a. pancreas b. skin c. heart d. eyes e. spine and skeleton f. colonarrow_forwardA company that manufactures cleansing products has synthesized two new organic compounds , chemicals A and B, which improve the cleaning power of dishwashing detergents. To determine the mutagenic capacity of the chemicals , the company tested the effect of the chemicals on Salmonella cells requiring histidine to grow ( His- cells ). The table below shows the results of the test . A. Name the test used by the company . B. What does the test detect or estimates ? C. Which chemical (s) would you identify as containing a mutagen ? Why ? D. What is the purpose of test 1 ? Why are colonies detected in test 1? E. Which chemical ( s) would you identify as possible antimutagen ? Why ?arrow_forward
- The photos below show flowers from two Arabidopsis plants. The plant on the left is wild-type (unmutated); the other carries a mutation that causes its flowers to have sepals and petals instead of stamens and carpels. The mutation inactivated one of the plant's ABC floral identity genes. Refer to Figure 10.8 and decide which gene (A, B, or C) has been inactivated.arrow_forwardGene expression does not vary by ________. a. cell type c. stage of development b. extracellular conditions d. the genetic codearrow_forwardEnhanced Spatial Learning Ability in Mice Engineered to Carry an Autism Mutation Autism is a neurobiological disorder with symptoms that include impaired social interactions and repetitive, stereotyped patterns of behavior. Around 10 percent of autistic people also have an extraordinary skill or talent such as greatly enhanced memory. Mutations in the gene for neuroligin 3, an adhesion protein that connects brain cells, have been associated with autism. One of these mutations is called R451C because the altered gene encodes a protein with an amino acid substitution: a cysteine (C) instead of an arginine (R) in position 451. In 2007, Katsuhiko Tabuchi and his colleagues introduced the R451C mutation into the neuroligin 3 gene of mice. The researchers discovered that the genetically modified mice had impaired social behavior and superior spatial learning ability. Spatial learning in mice is tested with a water maze, which consists of a small platform submerged a bit below the surface or a pool of water so it is invisible to a swimming mouse. Mice do not particularly enjoy swimming, so they try to locate the hidden platform as quickly as they can. When tested again later, they remember the platforms location by checking visual cues around the edge or the pool. How quickly they remember is a measure of their spatial learning ability. FIGURE 15.14 shows some or Tabuchis result. FIGURE 15.14 Spatial learning ability in mice. Mice with a mutation in neuroligin 3 (R451C) were tested for learning performance: as compared with unmodified (wild-type) mice. Did the modified or the unmodified mice learn the location of the platform faster in the first test?arrow_forward
- Which of the following describes an oncogene Group of answer choices A. a gene that stimulates cell division that is malfunctioning B. a cell whose normal function is to cause cancer C. a gene that controls body axes D. a hox gene E. a gene that prevents tumorsarrow_forwardChoose the combination of answers that most accurately completes the statement.The lac operon is usually in the he position and is activated by a/an an molecule. a. on, repressor c. on, inducer b. off, inducer d. off, repressorarrow_forwardwhich of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY