![Pearson eText Biology: Science for Life -- Instant Access (Pearson+)](https://www.bartleby.com/isbn_cover_images/9780135214084/9780135214084_largeCoverImage.gif)
Concept explainers
To write:
Whether there is any similarity between the codons that code for same amino acids.
Introduction:
The mRNA consists of many bases. A collection of three bases that has the capability to code for a particular amino acid is called codon. Codons are present in the mRNA.
To write:
The reason that mutation affecting the nucleotide in the third position of a codon is less likely to affect the structure of protein than a mutation that affects the first position of the codon
Introduction:
The group of three bases that codes for amino acids is called a codon. The codon is composed of first, second, and third position. The amino acids join together to form a protein. The mRNA produces by the process of transcription contains codons.
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 10 Solutions
Pearson eText Biology: Science for Life -- Instant Access (Pearson+)
- Is it reasonable that codons for the same amino acid have one or two nucleotides in common? Why or why not?arrow_forwardHere is our DNA sequence: T-A-C-A-T-G-T-T-T-A-G-G-T-C-C-A-C-C-C-G-T-G-G-G-A-C-T Write the RNA sequence below as codons (separated by hyphens). What is your amino acid sequence? The codon table with amino acid sequence is section 6.7 of your textbook. (Separate the amino acids by hyphens.) Again, be sure to note the start and stop codons. What is the name of the process of creating an amino acid sequence from RNA? What would happen if, in the middle of your gene sequence, the DNA was transcribed into the letters UAA on the mRNA strand? What effect might this have on the gene/trait? Using the DNA strand (in the box below), provide the complement which would be made through DNA replication. T-A-C-A-T-G-T-T-T-A-G-G-T-C-C-A-C-C-C-G-T-G-G-G-A-C-T Where does each of the following processes occur within the cell? Transcription: Translation: DNA Replication:arrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for proteins in this mRNA?c. what stop codon is present in this mRNA?arrow_forward
- During planetary exploration a new life form is discovered which has a DNA genome containing 6 different bases rather than the familiar four. The life form contains proteins with 25 different amino acids. Codons on Earth comprise three nucleotides; assuming a non-overlapping genetic code that includes initiation and termination codons, how many nucleotides would you predict to constitute a codon in the new life form, assuming all codons to be the same length? Briefly explain your answer.arrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the RNA synthesized above (item #3) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for a protein in this mRNA?c. what stop codon is present in this mRNA?arrow_forwardThis activity breaks down protein synthesis using the metaphor of PIZZA! Use your Amino Acids Reference Sheet to complete the following table. Fill in the blank spaces of each row with either the missing DNA triplet, the mRNA codon, or the Amino Acid. While there are actually multiple codons that code for any one amino acid, for this activity there only needs to be one DNA triplet and one corresponding mRNA codon recorded for each amino acid. Remember: RNA uses uracil (U) instead of thymine (T)! TTG GGG CGT AAA TTT CAA DNA AAC UAU CAC GCA AAA mRNA codon Asparagine Proline Tyrosine Amino Acid Histidinearrow_forward
- The genetic information contained in DNA consists of a linear sequence of coding units known as codons. Each codon consists of three adjacent DNA nucleotides that corresponto a single amino acid in a protien. The E.coli DNA molecule contains 4.70 x 10^6 base pairs. Determine the number of codons that can be present. Assuming that the average protein in E.coli consists of a chain of 400 amino acids, calculate the maximum number of protiens that can be coded by an E.coli DNA molecule.arrow_forwardLook at Table 26.3 and find codons for the following amino acids:(a) Val (b) Arg (c) Serarrow_forwardIn how many cases in the genetic code would it NOT be possible to know the amino acid specified by a codon if only the first two nucleotides of the codon are known?arrow_forward
- explain why a mutation in the dna nucleotide sequence that corresponds to the 3rd nitrogen base in the mrna codon is not as serious as a mutation in the dna that corresponds to the first nitrogen base in the mrna codonarrow_forwardCompare the codons with a pyrimidine, either U or C, as the second base. Do the majority of the amino acids specified by these codons have hydrophobic or hydrophilic side chains?arrow_forwardTranslate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)