Pearson eText Biology: Science for Life -- Instant Access (Pearson+)
6th Edition
ISBN: 9780135214084
Author: Colleen Belk, Virginia Maier
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 10, Problem 3AAATB
Summary Introduction
To write:
The site at which the restriction enzymes cuts the DNA.
Introduction:
Genome is defined as the complete genetic material that is present in an organism. It consists of the coding as well as the non-coding parts of DNA. The study of the genome is termed as genomics. Restriction enzymes are widely used enzymes in the field of genomics. This enzyme was discovered by three scientists named “Werner Arber, Hamilton Smith, and Daniel Nathans”.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The double stranded DNA sequence shown contains the promoter for the transcription of a
bacterial gene.
GGCACCTGCGATGCATGAATATATCGATCGGGAATCGCTATGTCAAGCCATGGCTAGATTA
CCGTGGACGCTACGTACTTATATAGCTAGCCCTTAGCGATACAGTTCGGTACCGATCTAAT
Draw a box around each of the promoter elements and identify each.
Identify which strand will be used as the template strand by putting a vertical line between the -1/+1 start
site nucleotides and underlining in the direction of transcription on the template strand as the example
below indicates.
ATCGG\GAATCGC
TAGCCCTTAGCG
Give the sequence of the RNA created
The partial sequence of one strand of a double-stranded DNA molecule is
5'-GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG
-3'
EcoRI is a restriction enzyme that cleaves after G in the sequence 5'-GAATTC-3'. PstI is a restriction enzyme that cleaves after
A in the sequence 5'-CTGCAG-3'.
Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The first
strand of your duplex DNA fragment should be derived from the given strand sequence.
5'-
-3'
3'-
-5'
List the sequences of RNA that would be transcribed from the following DNA template sequences.
TTACACTTGCTTGAGAGTC
ACTTGGGCTATGCTCATTA
GGCTGCAATAGCCGTAGAT
GGAATACGTCTAGCTAGCA
Chapter 10 Solutions
Pearson eText Biology: Science for Life -- Instant Access (Pearson+)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- For a restriction enzyme that recognizes the restriction site GGCC, Which of the following statements is/are true?arrow_forwardGiven the Following DNA template, TAC CGC TCC GCC GTC GAC AAT ACC ACT, write out the cDNA, mRNA, tRNA anticodons, and Give the amino acid sequence. What are the three possible outcomes if a Base Substitution mutation were to occur to the template?arrow_forwardFor the DNA sequence shown, indicate the products of its cleavage with the following restriction endonucleases (AKA restriction enzymes):5′-ACAGCTGATTCGAATTCACGTT-3′3′-TGTCGACTAAGCTTAAGTGCAA-5′a) EcoRI (the recognition sequence and cleavage site is G↓AATTC);b) AluI (the recognition sequence and cleavage site is AG↓CT).arrow_forward
- The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCGarrow_forwardDefine about Alu family (the name is based on the presence of DNA sequences recognized by the restriction endonuclease AluI)arrow_forwardThe sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.arrow_forward
- A new restriction enzyme is discovered. It recognizes a 6 base pair pallindromic sequence. The first three bases of the target sequence are are given below with the cut identified by ^. Answer the following questions: Target sequence: 5' G^TA _ _ _ 3'3' _ _ _ _ _ _ 5' 1) Complete the target sequence with all missing bases. Also include the position of the cut in the lower sequence(^) 2) What kind of clevage does the enzyme use?arrow_forwardFor the following DNA bases, give the complementary mRNA code that would be transcribed from these bases: AGCTAATCGGCTACCAGGTACGGATATTCCarrow_forwardWrite the base sequence of the DNA template from whichthis RNA sequence was derived: GUAUCAAUGAACUUG.How many amino acids are coded for in this sequence?arrow_forward
- For Pet41 (choose Pet41 a, b, or c as provided in the image) how would you design the primers (forward and reverse) for the following gene of interest and what restriction enzymes would be used (as shown in the image)? Be sure to explain and elaborate on why selected and how. Gene of Interest: atgggc gacaaaggga 241 cccgagtgtt caagaaggcc agtccaaatg gaaagctcac cgtctacctg ggaaagcggg 301 actttgtgga ccacatcgac ctcgtggacc ctgtggatgg tgtggtcctg gtggatcctg 361 agtatctcaa agagcggaga gtctatgtga cgctgacctg cgccttccgc tatggccggg 421 aggacctgga tgtcctgggc ctgacctttc gcaaggacct gtttgtggcc aacgtacagt 481 cgttcccacc ggcccccgag gacaagaagc ccctgacgcg gctgcaggaa cgcctcatca 541 agaagctggg cgagcacgct taccctttca cctttgagat ccctccaaac cttccatgtt 601 ctgtgacact gcagccgggg cccgaagaca cggggaaggc ttgcggtgtg gactatgaag 661 tcaaagcctt ctgcgcggag aatttggagg agaagatcca caagcggaat tctgtgcgtc 721 tggtcatccg gaaggttcag tatgccccag agaggcctgg cccccagccc acagccgaga 781 ccaccaggca gttcctcatg tcggacaagc ccttgcacct…arrow_forwardGiven below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’ 5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’arrow_forwardWhy would you NOT expect a restriction endonuclease to exist that would recognize the site AAGGAA?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY