Pearson eText Biology: Science for Life -- Instant Access (Pearson+)
6th Edition
ISBN: 9780135214084
Author: Colleen Belk, Virginia Maier
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 10, Problem 5LTB
Summary Introduction
Introduction:
The cells perform several activities for their survival. These activities are called cellular activities. Replication, transcription and translation are important cellular activities.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
During transcription, ___________________.
a. A cell divides to make 2 new cells
b. A cell divides to make 4 new cells
c. DNA is used as a template to create mRNA
d. mRNA, rRNA, and tRNA work together to make proteins
Select the most complete list of correct structures involved in the process of transcription
a.
mRNA, amino acids, ribosomes, polypeptide chains
b.
DNA, mRNA, RNA polymerase, a promoter
c.
mRNA, polypeptide chains, RNA polymerase
d.
DNA, mRNA, amino acids
A scientist is interested in producing flowers with a darker red color. To do this, the scientist alters the promoter of the gene to make it more active. This results in increased transcription and increased red pigments. The scientist then alters the promoter to make it even more active. This results in white flowers with no red pigment. Genetic research showed an increase in the siRNA in the cell. What did the siRNA do to the mRNA?
A. The siRNA caused the mRNA to be broken down.
B. The siRNA caused alternative splicing of the mRNA.
C. The siRNA caused increased methylation of the mRNA.
D. The siRNA caused the ribosome to no longer recognize this mRNA.
Chapter 10 Solutions
Pearson eText Biology: Science for Life -- Instant Access (Pearson+)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A promoter is ______. a. a specific sequence of DNA nucleotides b. a specific sequence of RNA nucleotides c. a protein that binds to DNA d. an enzyme that synthesizes RNAarrow_forwardIf the sequence of DNA on the template strand of a gene is AAA,the mRNA codon produced by transcription will be _______ andwill specify the amino acid _______ .a. AAA, lysineb. AAA, phenylalaninec. TTT, arginined. UUU, phenylalaninee. TTT, lysinearrow_forwardChoose the DNA sequence from which this mRNA sequence wastranscribed: 5′-AUACGAUUA-3′.a. 3′-TATGCTAAT-5′ c. 3′-UAUCGUAAU-5′b. 3′-UTUGCUTTU-5′ d. 3′-CTCAGCTTC-5′arrow_forward
- Which of the following phrases does not describe a function of the promoter? a. Serves as sequence to which transcription apparatus binds b. Determines the first nucleotide that is transcribed into RNA c. Determines which DNA strand is template d. Signals where transcription endsarrow_forwardWhich of the following are steps of transcription? Select all that apply. a.RNA polymerase assembles a strand of mRNA complementary to the noncoding strand of DNA. b.RNA polymerase binds to a gene’s promoter. c.RNA polymerase assembles a strand of mRNA complementary to the coding strand of DNA. d.RNA polymerase moves over the gene and unzips the double helix to form a “transcription bubble.”arrow_forwardWhich statement/s is/are TRUE about transcription?A. During transcription, DNA polymerase binds to RNA and separates the DNA strands.B. RNA polymerase uses one strand of DNA as a template to assemble nucleotides into a strand of RNA.C. RNA polymerase binds only to DNA promoters, which have specific base sequences.D. Promoters are signals in RNA that indicate to RNA polymerase where to begin transcription.E. Transcription occurs in the 3’ to 5’ direction with respect to the growing mRNA strand.arrow_forward
- Imagine that a mutation in a DNA molecule results in the codon CCU being changed to CCC. Both of these codons code for proline. The fact that more than one codon can code for the same amino acid is referred to as ___ a. the ambiguity of the genetic code b. the redundancy of the genetic code c. the randomness of the genetic code d. mutations in the genetic codearrow_forwardUse the Genetic Code below to help you answer the following questions. The nucleotide sequence of a hypothetical eukaryotic gene is: 3'- CCC CAT CAG TCA AGG GAA - 5' a. Provide the mRNA of the non-mutated gene. b. Provide the linear amino acid sequence of the non-mutated gene. üü c. Examine the mutated DNA sequence below. What would be the sequence of the mRNA? ü Mutated DNA sequence: 3' CCC CAC AGT CAA GGG AA 5' d. Provide the linear amino acid sequence of the mutated gene and identify the type of mutation. e. Comment on the consequences of this type of mutation?arrow_forwardWhich of the following are steps of transcription? Select all that apply. A. RNA polymerase binds to a gene’s promoter. B. RNA polymerase moves over the gene and unzips the double helix to form a “transcription bubble.” C. RNA polymerase assembles a strand of mRNA complementary to the coding strand of DNA. D. RNA polymerase assembles a strand of mRNA complementary to the noncoding strand of DNA.arrow_forward
- Which of the following rows identifies the mutated DNA sequence, complementary mRNA sequence, and resulting amino acid in a person with metabolic syndrome? Complementary mRNA Resulting Amino Acid Row A B D. OC. C D. D C Select one: OA A OB B Mutated DNA ATG ATG ACT ACT Metabolic syndrome is a genetic disorder with symptoms such as hypertension, elevated blood cholesterol, and low blood magnesium concentrations. This syndrome is caused by a mutation in which a cytosine nucleotide in the codon ACG is replaced by a thymine nucleotide. Use the following to answer the next AUG UAC ACU UGA Methionine Tyrosine Threonine Stoparrow_forwardUse the pre-mRNA sequence shown below to answer the following questions. MRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3' a. Underline the 5' and 3' splice sites, then write the sequence of the spliced mRNA in the space provided. b. Predict what would happen if the G in the 5' splice site were mutated to a C. c. We learned in this topic that the 5' cap in an mRNA plays a role in translation initiation. What do you think is one plausible mechanism by which a 5' cap can enhance initiation ? How can you experimentally demonstrate that a 5' cap is important for this process ?arrow_forwardWhich of the following statements are NOT true? A. Replication is the process of making DNA and takes place in the nucleus of prokaryotic cells. B. Translation produces a polypeptide that may require additional processing to become a functional protein C. Transcription starts at the promoter of eukaryotic cells and scans until reaches the start codon. D. Splicing results in exons being put together and introns being removedarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY