BIOLOGY
4th Edition
ISBN: 9781266739606
Author: Hoefnagels
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 10, Problem 1WIO
Summary Introduction
To explain:
The link between an organism’s genotype (for that gene) and its corresponding
Concept introduction:
The DNA act as genetic material which carries information that passes to the next generation. The DNA includes genes and every gene contains a pair of alleles. The DNA present in nucleus divided into chromosomes (long strand of DNA).
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg-tyr. A mutation in this gene removes the first G in the strand.What is true of this mutation's effect on the phenotype?1.It will affect the phenotype because although most of the protein will be identical, the first amino acid will be different.2.It will not affect the phenotype because the protein will be identical to the original protein.3.It will affect the phenotype because all the amino acids past this point will be different from the original protein.4.It will not affect the phenotype because only the first amino acid is different from the original protein.
Determine which statements could be used as evidence to support the argument that "DNA
influences the proteins that are made" and which statements are just facts.
[Select all that apply.]
The HBB gene that makes beta-globin has several abnormal alleles, including HbS, HbC, and HbE.
Sickle cell disease has been successfully treated using bone marrow transplantation in children and
adults.
The symptoms of sickle cell anemia may not appear in individuals who only carry one HbS allele, but
are always apparent when both alleles are HbS.
If oxygen is removed from red blood cells made by two HbS alleles, the cell will form a sickle shape.
Match each formatting of "white" to what it represents in genetics.
options:
white
WHITE (all capital letters)
white (in italics)
1.
phenotype
2.
gene
3.
protein
Chapter 10 Solutions
BIOLOGY
Ch. 10.1 - Describe the relationships among chromosomes, DNA,...Ch. 10.1 - Prob. 2MCCh. 10.2 - Why did Gregor Mendel choose pea plants as his...Ch. 10.2 - Distinguish between dominant and recessive;...Ch. 10.2 - Prob. 3MCCh. 10.3 - What is a monohybrid cross, and what are the...Ch. 10.3 - How are Punnett squares helpful in following...Ch. 10.3 - Prob. 3MCCh. 10.3 - How does the law of segregation reflect the events...Ch. 10.4 - Prob. 1MC
Ch. 10.4 - Prob. 2MCCh. 10.4 - How can the product rule be used to predict the...Ch. 10.5 - How do patterns of inheritance differ for unlinked...Ch. 10.5 - What is the difference between recombinant and...Ch. 10.5 - Prob. 3MCCh. 10.6 - Prob. 1MCCh. 10.6 - Differentiate between pleiotropy and epistasis.Ch. 10.6 - How can the same phenotype stem from many...Ch. 10.6 - Figures 10.18 and 10.20 show two ways that a...Ch. 10.7 - Prob. 1MCCh. 10.7 - Prob. 2MCCh. 10.7 - Why do males and females express recessive...Ch. 10.7 - Prob. 4MCCh. 10.8 - How are pedigrees helpful in determining a...Ch. 10.8 - Prob. 2MCCh. 10.9 - Prob. 1MCCh. 10.9 - What is polygenic inheritance, and how is it...Ch. 10.10 - Prob. 1MCCh. 10.10 - Prob. 2MCCh. 10 - In the list of four terms below, which term is the...Ch. 10 - According to Mendel, if an individual is...Ch. 10 - Prob. 3MCQCh. 10 - Each letter below represents an allele. Which of...Ch. 10 - Which of the following is a possible gamete for an...Ch. 10 - Use the product rule to determine the chance of...Ch. 10 - Refer to the linkage map in figure 10.16b. A...Ch. 10 - How can epistasis decrease the number of...Ch. 10 - Prob. 9MCQCh. 10 - Prob. 10MCQCh. 10 - Prob. 1WIOCh. 10 - Prob. 2WIOCh. 10 - Some people compare a homologous pair of...Ch. 10 - How did Mendel use evidence from monohybrid and...Ch. 10 - Prob. 5WIOCh. 10 - Prob. 6WIOCh. 10 - Prob. 7WIOCh. 10 - Prob. 8WIOCh. 10 - Prob. 9WIOCh. 10 - A family has an X-linked dominant form of...Ch. 10 - X inactivation explains the large color patches in...Ch. 10 - Prob. 12WIOCh. 10 - Prob. 13WIOCh. 10 - Prob. 14WIOCh. 10 - Design an experiment using twins to determine the...Ch. 10 - Prob. 1GPCh. 10 - In Mexican hairless dogs, a dominant allele...Ch. 10 - A species of ornamental fish comes in two colors;...Ch. 10 - Two lizards have green skin and large dewlaps...Ch. 10 - Prob. 5GPCh. 10 - Prob. 6GPCh. 10 - Prob. 7GPCh. 10 - Prob. 8GPCh. 10 - Prob. 1PITCh. 10 - Explain the effects of a mutation, using allele,...Ch. 10 - 3. Add meiosis, gametes, incomplete dominance,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGGGATAAACTC The left end of this molecule is the end. How many amino acids will be in the protein translated from this sequence? What is the name (not abbreviation) of the fourth amino acid in the protein translated from this sequence? The label on the end of the protein that is translated first is the + Jend.arrow_forwardYou have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined changes to to a C the result will be - A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutation You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined is deleted, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutatio If there are 3000 bases in the coding region of a gene, the gene will have A) 3000 amino acids B) 6000 amino acids C) 1000 amino acids D) 3000 codonsarrow_forwardFor questions 1-4, fill in the DNA, mRNA and/or protein sequence.... For questions 1-4, fill in the DNA, mRNA and/or protein sequence. Fill in the DNA and mRNA three nucleotides (one codon) at a time. Fill in the protein sequence by typing in the amino acid found in the genetic code table. Type in the three letter abbreviation. For example, type in "Met" instead of "Methioine". For the stop codon, type in "stop". Capitalization doesn't matter when filling in the sequences of the amino acids. You will need to have a copy of the genetic code handy when completing this activity. Remember The two DNA strands must be complementary. That is, A pairs with T and C pairs with G. The template strand of DNA is transcribed into mRNA using our base-pairing rules. When making RNA, U is used in place of T. This means that if there is an A in the template DNA strand, there will be a U in the mRNA strand. Each codon (3 nucleotides) of the mRNA is translated into an amino acid to build a protein. Look…arrow_forward
- Use the following information to answer the next question. The DNA strand shown below is thought to contain the genetic code for part of an enzyme B-galactosidase which is involved in lactose metabolism. (Read the DNA beginning at the left.) -A-T-A-T-G-G-G-G-C-A-T-G The second amino acid coded from the section of DNA for B-galactosidase is Select one: a. thymine b. tryptophan c. serine d. threoninearrow_forwardIt is found at a specific spot within a gene that represents a variation of that gene. * Genetics Gene Heredity Allelearrow_forwardFollow these directions to access the entries for PTGS1 and PTGS2 in the “Gene” database at the NCBI Website:A. First, go to the NCBI homepage using the link on the lab webpage, or by going to: http://www.ncbi.nlm.nih.gov Select “Gene” from the database pulldown menu. Type “PTGS” in the search box, then click “Go.” Scan the results for the “Homo sapiens” entries. There should be one called “PTGS1” and one called “PTGS2.” Select each entry by clicking on its name, then read the paragraph under the “Summary” section for each entry. The drug Celebrex selectively inhibits PTGS2 while aspirin and other NSAID’s inhibit both PTGS1 and PTGS2 in the same way. Why do you think researchers wanted to discover a selective inhibitor to PTGS2? 2. Describe how studying 3-D structures of PTGS1 and PTGS2 could help researchers design a drug that binds to PTGS1, but not to PTGS2.arrow_forward
- Hemoglobin, a protein found in red blood cells, carries oxygen. Abnormal hemoglobin cannot carry as much oxygen as normal hemoglobin. The sequences below show sections of the DNA sequence that produce both the normal and abnormal types of hemoglobin. Section of Gene for Hemoglobin Normal DNA sequence: GGA CTC CTC Abnormal DNA Sequence: GGA CAC CTCarrow_forwardTHE INSTRUCTION IS TO ILLUSTRATE SO DRAW THE ANSWER. DO NOT JUST PUT WORDS OF DEFINITION. REFER TO THE INSTRUCTIONarrow_forwardThe sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. ССТАССТТАТGCСАAGTTGGGGATАААСТС The left end of this molecule is the end. How many amino acids will be in the protein translated from this sequence? What is the name (not abbreviation) of the fourth amino acid in the protein translated from this sequence? The label on the end of the protein that is translated first is th v end. 5' Please answer all parts of the question. carboxyl 3' aminoarrow_forward
- Determine which statements could be used as evidence to support the argument that “DNA influences the proteins that are made” and which statements are just facts. [Select all that apply.] Group of answer choices The symptoms of sickle cell anemia may not appear in individuals who only carry one HbS allele, but are always apparent when both alleles are HbS. If oxygen is removed from red blood cells made by two HbS alleles, the cell will form a sickle shape. The HBB gene that makes beta-globin has several abnormal alleles, including HbS, HbC, and HbE. Sickle cell disease has been successfully treated using bone marrow transplantation in children and adults.arrow_forwardDiscuss and make a list of some of the reasons why determining theamount of a particular gene product would be useful to a geneticist.Use specific examples of known genes (e.g., β-globin gene andother genes) when making your list.arrow_forwardIn which tissue(s) is your protein NOT expressed in? 1. Go to: https://www.proteinatlas.org/2. Type the name of your protein in the search bar. Click "Search" 3. Click on the gene name of your protein4. Click on the "Tissue" icon A.BloodB.BrainC.PancreasD.Adipose and soft tissue Eyearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License