Essentials of Genetics, Books a la Carte Plus Mastering Genetics with eText -- Access Card Package (9th Edition)
Essentials of Genetics, Books a la Carte Plus Mastering Genetics with eText -- Access Card Package (9th Edition)
9th Edition
ISBN: 9780134319070
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 10, Problem 22PDQ
Summary Introduction

To review:

An experiment similar to Taylor, Woods, and Hughes that unequivocally establishes the fact that DNA (deoxyribonucleic acid) replication is conservative in nature.

Introduction:

In the conservative mode of replication, the complementary chain of polynucleotides is synthesized. After the synthesis, the parental strands do not separate from each other instead reassociate following the replication and the newly synthesized strands come together and combined with each other. So in this mode of replication draughter strand is completely new DNA strand.

Blurred answer
Students have asked these similar questions
What are the three models of DNA replication? With the aid of illustrations, show how the Meselson Stahl experiment come to the conclusion of one model of DNA replication. Is DNA replication bidirectional? How did you arrive at this conclusion? Explain the bacterial replication model that supports this conclusion.
You conducted an experiment to determine the mechanism of DNA replication in the hypothetical organism Fungus mungus. Your data shows that synthesis of  newly replicated DNA from F. mungus is discontinuous on both strands of the replication fork. Does this result support or not support the hypothesis that F. mungus replicates its DNA by the same mechanism as yeast? Briefly explain your answer.
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license