Concept explainers
Genomic DNA from the nematode worm Caenorhabditiselegansis organized by nucleosomes in the manner typical of eukaryotic genomes, with
Approximately what range of DNA fragment sizes do you expect to see in the stained electrophoresis gel? How many bands will be visible on the gel?
Explain the origin of DNA fragments seen in the gel.
How do the expected results support the
Want to see the full answer?
Check out a sample textbook solutionChapter 10 Solutions
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
- Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?arrow_forwardWe seem to know more about the structure of eukaryotic chromosomal DNA than bacterial DNA. Discuss why you think this is so,and list several experimental procedures that have yielded important information concerning the compaction of eukaryoticchromatinarrow_forwardGiven the fact that 1 fg of DNA = 9.78 * 105base pairs (on average), you can convert the amount of DNA per cell to the lengthof DNA in numbers of base pairs. (a) Calculate the number of basepairs of DNA in the haploid yeast genome. Express your answer inmillions of base pairs (Mb), a standard unit for expressing genomesize. Show your work. (b) How many base pairs per minute weresynthesized during the S phase of these yeast cells?arrow_forward
- As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardFor a linear B-DNA molecule of 50,000 kb, calculate (a) the contour length and (b) the length of the DNA as packaged in nucleosomes with linker histones present.arrow_forwardMammals contain a diploid genome consisting of at least 109 bp. If this amount of DNA is present as chromatin fibers, where each group of 200 bp of DNA is combined with 9 histones into a nucleosome and each group of 6 nucleosomes is combined into a solenoid, achieving a final packing ratio of 50, determine (a) the total number of nucleosomes in all fibers, (b) the total number of histone molecules combined with DNA in the diploid genome, and (c) the combined length of all fibers.arrow_forward
- An article entitled “Nucleosome Positioning at the Replication Fork” states: “both the ‘old’ randomly segregated nucleosomes as well as the ‘new’ assembled histone octamers rapidly position themselves (within seconds) on the newly replicated DNA strands” [Lucchini et al. (2002)]. Given this statement, how would one compare the distribution of nucleosomes and DNA in newly replicated chromatin? How could one experimentally test the distribution of nucleosomes on newly replicated chromosomes?arrow_forwardMultiple Replication Forks in E. coli I Assuming DNA replication proceeds at a rate of 750 base pairs per second, calculate how long it will take to replicate the entire E. coli genome. Under optimal conditions, E. coli cells divide every 20 minutes. What is the minimal number of replication forks per E. coli chromosome in order to sustain such a rate of cell division?arrow_forwardMultiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram illustrating replication of the circular E. coli chromosome (a) at an early stage, (b) when one-third completed, (c) when two-thirds completed, and (d) when almost finished, assuming the initiation of replication at oriC has occurred only once. Then, draw a diagram showing the E. coli chromosome in problem 3 where the E. coli cell is dividing every 20 minutes.arrow_forward
- Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example changes in the gene for adenomatous-polyposis-coli protein (APC gene) may result in colorectal cancer. Consider the following DNA sense strand. 3'-TAC CGG TTG TGA AGC TGA ATC-5' (i) (ii) (iii) (iv) Derive the mRNA molecule from the given DNA strand sequence above, paying attention to the polarity of the molecule. Write down the polypeptide chain sequence arising from the mRNA molecule of the question above, using the table of the genetic code (Table Q1 overleaf) and indicate the C- and the N-terminus of the peptide chain. Point mutations of a cytosine (C) often lead to the dysfunction of the APC protein. Write down all possible polypeptide chains that can result from all possible DNA mutations of cytosines, disregarding a mutation in the MET/START and STOP codons. I Specify which of the point mutations identified in (d) are redundant?arrow_forwardUnder physiological conditions, DNA ordinarily formsB-DNA. However, RNA hairpins and DNA-RNAhybrids adopt the structure of A-DNA. Considering thestructural differences between DNA and RNA, explain thisphenomenon.arrow_forwardThe sequences of DNA bases below represent parts of the genes responsible for the production of one type of protein, an enzyme, produced by Botana curus and Species X, Y, and Z Under each DNA sequence, write the complementary messenger RNA base sequences that each of these gene fragments would produce. Note: Unlike during DNA replication, in the production of messenger RNA, the DNA base “A” specifies the RNA base “U.”. Use the universal genetic code table provided (see Universal Code attachment) to translate the messenger RNA base sequences into sequences of amino acids in the protein produced by each species. Write the sequences of amino acids under the messenger RNA sequences.arrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning