Biochemistry
Biochemistry
8th Edition
ISBN: 9781285429106
Author: Campbell, Mary K., FARRELL, Shawn O.
Publisher: Cengage Learning,
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 10, Problem 28RE
Interpretation Introduction

Interpretation:

The common features of all DNA polymerases have to be discussed.

Concept introduction:

DNA (deoxyribonucleic acid) polymerases are the enzymes that synthesize DNA molecules with the help of deoxyribonucleotides that are the building block of DNA.

There are many enzymes that help the DNA polymerase to complete the process of replication. The replication of DNA occurs in the S-phase (synthesis phase) of the cell cycle. It is the first process of the central dogma.

Blurred answer
Students have asked these similar questions
(recall) During DNA replication one nucleotide strand is used as a template for polymerization of another. What WOULD BE THE NUCLEOTIDE (?) in the newly synthesized complementary DNA chain across from the nucleotide C template ATGCAGCTCCAGTCGGTAATG new strand O none of answers correct O Tor A O A

Chapter 10 Solutions

Biochemistry

Ch. 10 - RECALL Compare and contrast the properties of the...Ch. 10 - REFLECT AND APPLY Define processivity, and...Ch. 10 - REFLECT AND APPLY Comment on the dual role of the...Ch. 10 - REFLECT AND APPLY What is the importance of...Ch. 10 - REFLECT AND APPLY DNA synthesis always takes place...Ch. 10 - REFLECT AND APPLY What would happen to the...Ch. 10 - Prob. 17RECh. 10 - REFLECT AND APPLY Why is it not surprising that...Ch. 10 - Prob. 19RECh. 10 - RECALL List the substances required for...Ch. 10 - RECALL Describe the discontinuous synthesis of the...Ch. 10 - RECALL What are the functions of the gyrase,...Ch. 10 - RECALL Single-stranded regions of DNA are attacked...Ch. 10 - RECALL Describe the role of DNA ligase in the...Ch. 10 - RECALL What is the primer in DNA replication?Ch. 10 - Prob. 26RECh. 10 - REFLECT AND APPLY Why is a short RNA primer needed...Ch. 10 - Prob. 28RECh. 10 - RECALL What was the recent change in the estimated...Ch. 10 - Prob. 30RECh. 10 - RECALL Why is a clamp loader necessary in...Ch. 10 - RECALL How does proofreading take place in the...Ch. 10 - Prob. 33RECh. 10 - Prob. 34RECh. 10 - BIOCHEMICAL CONNECTIONS Of what benefit is it for...Ch. 10 - REFLECT AND APPLY Your book contains about 2...Ch. 10 - REFLECT AND APPLY E. coli incorporates...Ch. 10 - REFLECT AND APPLY Given the typing speed from...Ch. 10 - Prob. 39RECh. 10 - REFLECT AND APPLY How can breakdown in DNA repair...Ch. 10 - Prob. 41RECh. 10 - RECALL What is a direct way of repairing...Ch. 10 - Prob. 43RECh. 10 - Prob. 44RECh. 10 - Prob. 45RECh. 10 - Prob. 46RECh. 10 - RECALL How did Messelson and Weigle demonstrate...Ch. 10 - Prob. 48RECh. 10 - RECALL What is the Holliday Model?Ch. 10 - RECALL Do eukaryotes have fewer origins of...Ch. 10 - RECALL How does DNA replication in eukaryotes...Ch. 10 - Prob. 52RECh. 10 - REFLECT AND APPLY (a) Eukaryotic DNA replication...Ch. 10 - Prob. 54RECh. 10 - Prob. 55RECh. 10 - Prob. 56RECh. 10 - Prob. 57RECh. 10 - Prob. 58RECh. 10 - Prob. 59RECh. 10 - Prob. 60RECh. 10 - Prob. 61RECh. 10 - Prob. 62RECh. 10 - Prob. 63RECh. 10 - Prob. 64RE
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
  • Text book image
    Biochemistry
    Biochemistry
    ISBN:9781305961135
    Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
    Publisher:Cengage Learning
Text book image
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY