Concept explainers
Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book.
The Sequence Relationship Between an Antisense RNA Strand and Its Template DNA Strand The DNA strand that is complementary to the template strand copied by RNA polymerase during transcription has a
Want to see the full answer?
Check out a sample textbook solutionChapter 10 Solutions
Biochemistry
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. The Base Sequence in the Two Polynucleotide Chairs of a DNA Double Helix Is Complementary Adhering to the convention of writing nucleotide sequences in the 5' 3' direction, what is the nucleotide sequence of the DNA strand that is complementary to d-ATCGCAACTGTCACTA?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Designing Primers for PCR Amplification of a DNA Sequence Given the following short DNA duplex of sequence (53)ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCCA- CATGCACACACATGACATAGGACAGATAGCAT what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. The Relationship Between the Nucleotide Sequence of an mRNA and the DNA Strand from Which It Is Transcribed Messenger RNAs are synthesized by RNA polymerases That read along a DNA Template strand in The 3' 5' direction, polymerizing ribonucleotides in The 5' 3r direction (see Figure 10.20). Give the nucleotide sequence (5r 3') of the DNA template strand from which The following rnRNA segment was transcribed: 5'-LAGL GAC AGUUGCGAU-3'.arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Preparing cDNA Libraries from Different Cells Describe an experimental protocol for the preparation of to cDNA libraries, one from anaerobically grown yeast cells and the second from aerobically grown yeast cell.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Identifying DNA Structural and Functional Elements from Nucleotide Sequence Information Listed below are four DNA sequences. Which one contains a type-II restriction endonuclease (six-cutter) hexanucleotide site?. Which one is likely to form a cruciform structure? Which one is likely to be found in Z-DNA? Which one represents the 5'-end of a tRNA gene? Which one is most likely to be found in a triplex DNA structure? a. CGCGCGCCGCGCACGCGCTCGCGCGCCGC b. GAACGTCGTATTCCCGTACGACGTTC c. CAGGTCTCTCTCTCTCTCTCTC d. TGGTGCGAATTCTGTGGAT e. ATCGGAATTCATCGarrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Calculate the Frequency of Occurrence of an RNAi Target Sequence The RNAs acting in RNAi are about 21 nucleotides long. To judge whether it is possible to uniquely target a particular gene with a RNA of this size, consider The following calculation: What is the expected frequency of occurrence of a specific 21-nucleotide sequence?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Calculating Tms and Separating DNA Molecules That Differ in G:C Content At 0.2 M Na+, the melting temperature of double-stranded DNA is given by the formula, Tm = 69.3 + 0 41 (% G + C). The DNAs from mice and rats have (G + C) contents of 44% and 40%, respectively. Calculate the Tms for these DNAs in 0.2 M NaCl. If samples of these DNAs were inadvertently mixed, how might they be separated from one another?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. B- and Z-DNA Supercoiling Parameters Suppose one double helical turn of a superhelical DNA molecule changes conformation from B- to Z-form. What are the changes in L, W, and T? Why do you suppose the transition of DNA from B- to Z-form is favored by negative supercoiling?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Protein-DNA Interactions Gerie expression is controlled through the interaction of proteins with specific nucleotide sequences in double stranded DNA. List the kinds of noncovalent interactions that might take place between a protein and DNA. How do you suppose a particular protein might specifically interact with a particular nucleotide sequence in DNA'.’ That is. how might proteins recognize specific base sequences within the double helix?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. B-and Z-DNA Helical Parameters II If 80% of the base pairs in a duplex DNA molecule (12.5 kbp) are in the B-conformation and 20% are in the Z-conformation, what is the length of the molecule?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. B- and Z-DNA Helical Parameters I A 41.5-nm-long duplex DNA molecule in the B conformation adopts the A-conformation upon dehydration. How long is it now? What is its approximate number of base pairs?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Chargaff’s Rules for the Base Composition of DNA Chargaff’s results (Table 10.1) yielded a molar ratio of 1 1.29 for A to G in ox DNA, 1.43 for T to C, 1.04 for A to T, and 1.00 for G to C. Given these values, what are the approximate mole fractions of A. C, G. and T in ox DNA?arrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning