Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 11, Problem 18P
Interpretation Introduction
(a)
Interpretation:
The name of the protein affected by the disease, sickle cell anemia is to be stated.
Concept Introduction:
The genetic material of a living thing which contains DNA and RNA is known as genome. It consists of genes, non-coding DNA and the mitochondrial DNA. The human genome consists of a genome possessed by Homo sapiens that is composed of
Interpretation Introduction
(b)
Interpretation:
The name of the protein affected by the disease, Tay Sachs is to be stated.
Concept Introduction:
The genetic material of a living thing which contains DNA and RNA is known as genome. It consists of genes, non-coding DNA and the mitochondrial DNA. The human genome consists of a genome possessed by Homo sapiens that is composed of
Interpretation Introduction
(c)
Interpretation:
The name of the protein affected by the disease, Leprechaunism is to be stated.
Concept Introduction:
The genetic material of a living thing which contains DNA and RNA is known as genome. It consists of genes, non-coding DNA and the mitochondrial DNA. The human genome consists of a genome possessed by Homo sapiens that is composed of
Interpretation Introduction
(d)
Interpretation:
The name of the protein affected by the disease, Hartnup disorder is to be stated.
Concept Introduction:
The genetic material of a living thing which contains DNA and RNA is known as genome. It consists of genes, non-coding DNA and the mitochondrial DNA. The human genome consists of a genome possessed by Homo sapiens that is composed of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Chapter 11 Solutions
Biochemistry
Ch. 11 - Answers to all problems are at the end of this...Ch. 11 - Answers to all problems are at the end of this...Ch. 11 - Prob. 3PCh. 11 - Answers to all problems are at the end of this...Ch. 11 - Answers to all problems are at the end of this...Ch. 11 - Answers to all problems are at the end of this...Ch. 11 - Answers to all problems are at the end of this...Ch. 11 - Answers to all problems are at the end of this...Ch. 11 - Prob. 9PCh. 11 - Prob. 10P
Ch. 11 - Answers to all problems are at the end of this...Ch. 11 - Prob. 12PCh. 11 - Prob. 13PCh. 11 - Prob. 14PCh. 11 - Answers to all problems are at the end of this...Ch. 11 - Prob. 16PCh. 11 - Prob. 17PCh. 11 - Prob. 18PCh. 11 - Prob. 19PCh. 11 - Prob. 20PCh. 11 - Prob. 21PCh. 11 - Prob. 22PCh. 11 - Prob. 23P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Preparing cDNA Libraries from Different Cells Describe an experimental protocol for the preparation of to cDNA libraries, one from anaerobically grown yeast cells and the second from aerobically grown yeast cell.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Abundance of the Different Bases in the Human Genome Results on the human genome published in Science (Science 291 :1304—1350 [2001]) indicate that the haploid human genome consists of 2.91 gigabase pairs (2.91 X ]09 base pairs} and that 27% of the bases in human DNA are A. Calculate the number of A. T, G, and C residues in a typical human cell.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. CRISPR/Cas9: Design of a gRNA to Target the Human PVALB Gene The human PVALB gene, which encodes the Ca2+-binding protein parvalbumin, can be Targeted by CRISPR/Cas9, at the protospacer sequence - ATGCAGGAGGGTGGCGAGAGGGGCCGAGAT- followed by a -TGG-PAM trinucleotide. Give the sequence of the spacer region of a gRNA that will target the complementary DNA strand at this site. Include at the 3'-end of your gRNA sequence a region that will form a stem-loop structure with a 5'-AGCAUAGCUGUAAAAC- sequence downstream in the gRNA to create the dsRNA-binding site for Cas9.arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. An Estimation of Minimal Genome Size for a Living Cell Studies of existing cells to determine the minimum number of genes for a living cell have suggested that 206 genes are sufficient. If the ratio of protein-coding genes to non-protein-coding genes is the same in this minimal organism as the genes of Mycoplasma genitulium, how many proteins are represented in these 206 genes. How many base pairs would be required to form the genome of this minimal organism if the genes are the same size as M genilalium genes? (Section 1.5)arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Designing Primers for PCR Amplification of a DNA Sequence Given the following short DNA duplex of sequence (53)ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCCA- CATGCACACACATGACATAGGACAGATAGCAT what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Cells as Steady-State Systems Describe what is meant by the phrase "cells tire steady-state systems." (Section 1.4)arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Deducing DNA Sequence from Sanger Sequencing Results The output of an automated DNA sequence determination by the Sanger dideoxy chain termination method, performed as illustrated in Figure 11.3, is disp1ayed at right. What is the sequence of the original oligonucleotide?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Consider the following peptide sequences: EANQIDEMLYNVQCS LTTLE DTVPW LG VHLDITVPL SWTWTLYVKL QQNWGGLWILTLVWFLM CNMKHGDSQCDERTYP YTREQSDGHIPKMNCDS AGPFGPDGPTIGPK Which of the preceding sequences would be likely to be found in each of the following: A parallel -sheet An antiparallel -sheet A tropocollagen molecule The helical portions of a protein found in your hairarrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Calculating Tms and Separating DNA Molecules That Differ in G:C Content At 0.2 M Na+, the melting temperature of double-stranded DNA is given by the formula, Tm = 69.3 + 0 41 (% G + C). The DNAs from mice and rats have (G + C) contents of 44% and 40%, respectively. Calculate the Tms for these DNAs in 0.2 M NaCl. If samples of these DNAs were inadvertently mixed, how might they be separated from one another?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Calculate the Frequency of Occurrence of an RNAi Target Sequence The RNAs acting in RNAi are about 21 nucleotides long. To judge whether it is possible to uniquely target a particular gene with a RNA of this size, consider The following calculation: What is the expected frequency of occurrence of a specific 21-nucleotide sequence?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. The Sequence Relationship Between an Antisense RNA Strand and Its Template DNA Strand The DNA strand that is complementary to the template strand copied by RNA polymerase during transcription has a nucleotide sequence identical to that of the RNA being synthesized (except T residues are found in the DNA strand at sites where U residues occur in the RNA). An RNA transcribed from this nontem-plate DNA strand would be complementary to the mRNA synthesized by RNA polymerase. Such an RNA is called antisense RNA because its base sequence is complementary to the “sense mRNA. One strategy to thwart the deleterious effects of genes activated in disease slates (such as cancer) is to generate antisense RNAs in affected cells. These antisense RNAs would form double-stranded hybrids with mRNAs transcribed from the activated genes and prevent their translation into protein. Suppose transcription of a cancer-activated gene yielded an mRNA whose sequence included the segment 5’-UACGUCUAAGCUGA. What is the corresponding nucleotide sequence (5’ The template strand in a DNA duplex that might be introduced into these cells so that an untisense RNA could be transcribed from it?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Chargaff’s Rules for the Base Composition of DNA Chargaff’s results (Table 10.1) yielded a molar ratio of 1 1.29 for A to G in ox DNA, 1.43 for T to C, 1.04 for A to T, and 1.00 for G to C. Given these values, what are the approximate mole fractions of A. C, G. and T in ox DNA?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
DNA Use In Forensic Science; Author: DeBacco University;https://www.youtube.com/watch?v=2YIG3lUP-74;License: Standard YouTube License, CC-BY
Analysing forensic evidence | The Laboratory; Author: Wellcome Collection;https://www.youtube.com/watch?v=68Y-OamcTJ8;License: Standard YouTube License, CC-BY