BIOLOGY
4th Edition
ISBN: 9781266739606
Author: Hoefnagels
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Question
Chapter 11, Problem 5MCQ
Summary Introduction
Introduction:
DNA or deoxyribonucleic acid is the hereditary material that is present in all the organisms.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Which of the following represents the sequence of an RNA transcript for which the template strand of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written
5'-3'.
DA. GUACUGGCUAGCUGCUAGAA
B. UUCUAGCAGCUAGCCAGUAC
с. ТТСТАGCAGCTAGCCAGTАС
D. GTACTGGCТAGCTGCTAGAА
Give only typing answer with explanation and conclusion
The following bacterial DNA genome is composed of three sequences:
TGGCGGT / ACGTTAC / GGATAGG
Using your knowledge of CRISPRs, identify which of these sequences is/are most likely derived from viral DNA infection.
a.
TGGCGGT
b.
ACGTTAC
c.
GGATAGG
d.
Both a and c
Chapter 11 Solutions
BIOLOGY
Ch. 11.1 - Prob. 1MCCh. 11.1 - Prob. 2MCCh. 11.2 - What are some uses for transgenic organisms?Ch. 11.2 - Prob. 2MCCh. 11.2 - Prob. 3MCCh. 11.2 - What is the function of the 98.5% of the human...Ch. 11.2 - How does PCR work, and why is it useful?Ch. 11.2 - Prob. 6MCCh. 11.2 - Why do investigators sometimes analyze...Ch. 11.3 - Prob. 1MC
Ch. 11.3 - Prob. 2MCCh. 11.3 - Summarize the steps scientists use to clone an...Ch. 11.3 - Prob. 4MCCh. 11.4 - Prob. 1MCCh. 11.4 - Prob. 2MCCh. 11.4 - Prob. 3MCCh. 11.4 - What are some examples of ethical questions raised...Ch. 11.5 - Prob. 1MCCh. 11.5 - Prob. 2MCCh. 11 - If a restriction enzyme cuts between the G and the...Ch. 11 - Which of the following is not a reason that...Ch. 11 - Prob. 3MCQCh. 11 - Prob. 4MCQCh. 11 - Prob. 5MCQCh. 11 - Preimplantation genetic diagnosis would be least...Ch. 11 - Prob. 7MCQCh. 11 - What techniques might researchers use to create...Ch. 11 - Prob. 2WIOCh. 11 - Prob. 3WIOCh. 11 - Prob. 4WIOCh. 11 - Why are entire genomes not used for DNA profiling?Ch. 11 - In a 2013 investigation, researchers discovered...Ch. 11 - Unneeded genes in an adult animal cell are...Ch. 11 - Prob. 8WIOCh. 11 - Prob. 9WIOCh. 11 - If a cells genome is analogous to a cookbook and a...Ch. 11 - Review the Survey the Landscape figure in the...Ch. 11 - How does PCR relate to DNA profiling and...Ch. 11 - Add the terms restriction enzyme, plasmid, virus,...
Knowledge Booster
Similar questions
- Choose the combination of answers that most accurately completes the statement.Which of the following sequences, when combined with its complement, would be clipped by a restriction endonuclease? a. ATCGATCGTAGCTA c. GAATTC b. AAGCTTCGAA d. ACCATTGGAarrow_forwardThe chromatogram shows fluorescent peak data from a dye-terminating nucleotide-sequencing reaction. The peaks are shown with shortest fragment on the left to longer fragments on the right. T •C A Select the DNA sequence that matches the data. 5-ТАТAСТТАСGAAGT-3' 5'-GTCCTACGGACGCG–3' 5'-ATATGAATGCTTCA–3' 5'-TGAAGCATTCATAT–3' 5-АСТТCGTAAGTATA-3'arrow_forwardWhich of the following sequences, when combined with itscomplement, would be clipped by a restriction endonuclease?a. ATCGATCGTAGCTA b. AAGCTTCGAA c. GAATTC d. ACCATTGGAarrow_forward
- List the sequences of RNA that would be transcribed from the following DNA template sequences. TTACACTTGCTTGAGAGTC ACTTGGGCTATGCTCATTA GGCTGCAATAGCCGTAGAT GGAATACGTCTAGCTAGCAarrow_forwardWhich of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5'-3'. OA. AAGAUCGUCGAUCGGUCAUG OB. AAGATCGTCGATCGG TCATG OC. GTACTGGC TAGCTGC TAGAA OD. GUACUGGCUAGCUGCUAGAAarrow_forwardFor the following sequence of amino acids, serine-valine-lysine-leucine, which of the choices below is the correct order for the nucleotide base sequence in DNA? Group of answer choices a. UGUGCAAAGUUA b. AGACAATTCAAT c. TCTCGTTTGTTA d. TGTGCTTTCTTAarrow_forward
- You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA encoding this peptide is included in the sequence shown below. 5'-CGTGACGGCTCGTGGAAGCTAGTCATC-3' 3'-GCACTGCCGAGCACCTTCGATCAGTAG-5' This sequence does not contain any BamHI restriction enzyme sites. The target sequence for the BamHI restriction nuclease is GGATCC. Your goal is to create a BamHI site on this plasmid by manipulating the DNA sequence, without changing the coding sequence of the protein. How would you do this, ie what would the new sequence be?arrow_forwardSuppose you have subjected the two given samples of EcoRl digested DNA to get electrophoresis. Draw a diagram of the expected gel to show the location of the cut DNA pieces. arrow_forwardWhat is the answer choice? a. Silent b. Missense c. Nonsense d. Frameshiftarrow_forward
- Choose the combination of answers that most accurately completes the statement.For which of the following would a nucleic acid probe not be used? a. locating a gene on a chromosome b. developing a Southern blot c. identifying a microorganism d. constructing a recombinant plasmidarrow_forwardMatch the following polymerases with their function. + DNA Polymerase III DNA polymerase I + RNA polymerase + RNA polymerase II A. Polymerase responsible for proofreading DNA B. Polymerase responsible for making prokaryotic mRNA C. Polymerase responsible for making eukaryotic MRNA D. Polymerase responsible for making prokaryotic DNAarrow_forwardThe other options are: a. RNA cannot be digested by restriction enzymes b. RNA is small enough to be resolved on an agarose gel without the need for restriction digestion. c. RNA is single stranded and DNA is double strandedarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education