Biology: Concepts and Investigations
5th Edition
ISBN: 9781260542202
Author: Marielle Hoefnagels
Publisher: Mcgraw-hill Higher Education (us)
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11, Problem 7WIO
Unneeded genes in an adult animal cell are permanently inactivated, making it impossible for most specialized cells to turn into any other cell type. How does this arrangement save energy inside a cell? Why does the ability to clone an adult mammal depend on techniques for reactivating these “dormant” genes?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
You want to clone a eukaryotic gene and express the corresponding protein in yeast. However, the protein typically localizes within mitochondria. How will you perform your gene cloning so that the protein is secreted from the cell, rather than localized within yeast mitochondria?
You are interested in studying a novel gene that appears to be involved in cancer. There is no information about the function of this gene. What would you do to obtain the cDNA for this gene? How would you express this gene and what expression systems might you utilize to study its function and why? How would determine the subcellular localization of this gene in eukaryotic cells? What are alternative methods in case one doesn't work? How would you purify and determine the 3-dimensional structure of this protein?
You want to clone a eukaryotic gene and express the protein in yeast. The protein typically localizes in the mitochondria. What does your clone need so that the protein is localized in the ER rather than the mitochondria?
Chapter 11 Solutions
Biology: Concepts and Investigations
Ch. 11.1 - Prob. 1MCCh. 11.1 - Prob. 2MCCh. 11.2 - What are some uses for transgenic organisms?Ch. 11.2 - Prob. 2MCCh. 11.2 - Prob. 3MCCh. 11.2 - What is the function of the 98.5% of the human...Ch. 11.2 - How does PCR work, and why is it useful?Ch. 11.2 - Prob. 6MCCh. 11.2 - Why do investigators sometimes analyze...Ch. 11.3 - Prob. 1MC
Ch. 11.3 - Prob. 2MCCh. 11.3 - Summarize the steps scientists use to clone an...Ch. 11.3 - Prob. 4MCCh. 11.4 - Prob. 1MCCh. 11.4 - Prob. 2MCCh. 11.4 - Prob. 3MCCh. 11.4 - Prob. 4MCCh. 11.4 - What are some examples of ethical questions raised...Ch. 11.5 - Prob. 1MCCh. 11.5 - Prob. 2MCCh. 11 - If a restriction enzyme cuts between the G and the...Ch. 11 - Which of the following is not a reason that...Ch. 11 - Prob. 3MCQCh. 11 - Prob. 4MCQCh. 11 - Prob. 5MCQCh. 11 - Prob. 6MCQCh. 11 - Prob. 7MCQCh. 11 - What techniques might researchers use to create...Ch. 11 - Prob. 2WIOCh. 11 - Prob. 3WIOCh. 11 - Prob. 4WIOCh. 11 - Why are entire genomes not used for DNA profiling?Ch. 11 - In a 2013 investigation, researchers discovered...Ch. 11 - Unneeded genes in an adult animal cell are...Ch. 11 - Prob. 8WIOCh. 11 - Prob. 9WIOCh. 11 - Prob. 10WIOCh. 11 - If a cells genome is analogous to a cookbook and a...Ch. 11 - Prob. 12WIOCh. 11 - Review the Survey the Landscape figure in the...Ch. 11 - How does PCR relate to DNA profiling and...Ch. 11 - Add the terms restriction enzyme, plasmid, virus,...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Match the people in column A to their contribution toward the advancement of microbiology, in column B. Column ...
Microbiology: An Introduction (13th Edition)
Nursing Student with Neuropathic Pain
Tamara Costa broke her right tibia and has undergone two separate surger...
Human Anatomy & Physiology (11th Edition)
What were the major microbiological interests of Martinus Beijerinck and Sergei Winogradsky? It can be said tha...
Brock Biology of Microorganisms (14th Edition)
Physiology a. deals with the processes or functions of living things. b. is the scientific discipline that inve...
SEELEY'S ANATOMY+PHYSIOLOGY
To test your knowledge, discuss the following topics with a study partner or in writing ideally from memory. Th...
Human Anatomy
How does trandlation differ from transcription?
Microbiology: Principles and Explorations
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Although several different mammalian species have been cloned, the efficiency of this process is extremely low. Often tens or even hundreds of oocytes must be implanted with donor nuclei to obtain one healthy live birth. Many researchers believe the difficulties with cloning reside in the epigenetic modifications, such as DNA and histone methylation, that occur within various cells during an individual’s life. How do you suspect such modifications might affect the success of an experimentarrow_forwardMost organisms display a circadian rhythm, a cycling of biological processes that is roughly synchronized with day length. In Drosophila, pupae eclose (emerge as adults after metamorphosis) at dawn. a)Using this knowledge how would screen for Drosophila mutants that have an impaired circadian rhythm? b)In each case, how would you clone the genes you identified by mutation?arrow_forwardBy whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…arrow_forward
- Scientists carried out a microarray analysis to compare the gene expression of normal pancreatic cells to that of cancer cells from a person with pancreatic cancer. The scientists labeled the cDNA from the normal pancreatic cells with green fluorescent nucleotides. They labeled the cDNA from the cancer cells with red fluorescent nucleotides. The two cDNAs were mixed and allowed to hybridize to a microarray. Less p53 activity is found in cancer pancreatic cells than normal cells. What color would the spot for the p53 gene be on the microarray? Red Green Yellow Blackarrow_forwardWoolly mammoths have been extinct for about 10,000 years, but we often find their well- preserved remains in Siberian permafrost. Research groups are now planning to use SCNT to resurrect these huge elephant- like mammals. No mammoth eggs have been recovered so far, so elephant eggs would be used instead. An elephant would also be the surrogate mother for the resulting embryo. The researchers may try a modified SCNT technique used to clone a mouse that had been dead and frozen for sixteen years. Ice crystals that form during freezing break up cell membranes, so cells from the frozen mouse were in bad shape. Their DNA was transferred into donor mouse eggs, and cells from the resulting embryos were fused with mouse stem cells. Four healthy clones were born from the hybrid embryos. What are some of the pros and cons of cloning an extinct animal?arrow_forwardFrom gene expression studies on cancer, you discovered a hypothetical gene called ABCG2 that is overexpressed in human cancer cells. You want to know if this gene is required for cancer cells to survive, but from your efforts at making a traditional gene knock out, you have found that it is required for embryonic development and can't get to the point of doing a cancer experiment. a. How can you redesign the knockout to get past embryonic lethality? b. How would you then use this mouse line to test if ABCG2 is needed for cancer survival?arrow_forward
- In contrast with the genomic manipulations of animals and plants described in this chapter, human genetherapy is directed specifically at altering the genomes of somatic cells rather than germ-line cells.Why couldn’t or wouldn’t medical scientists try to alter the genome of human germ-line cells?arrow_forwardNorthern blotting, RT-PCR, and microarrays can be used to analyze gene expression. A lab studies yeast cells, comparing their growth in two different sugars, glucose and galactose. One student is comparing expression of the gene HMG2 under these two conditions. Which technique(s) could he use and why? Another student wants to compare expression of all the genes on chromosome 4, of which there are approximately 800. What technique(s) could she use and why?arrow_forwardAll the cells of one organism share the same genome. However, during development, some cells develop into skin cells while others develop into muscle cells. Briefly explain how the same genetic instructions can result in two different cell types in the same organism.arrow_forward
- Woolly mammoths have been extinct for about 4,000 years, but we often find their well-preserved remains in Siberian permafrost. Research groups are now planning to use SCNT to resurrect these huge elephant-like mammals. No mammoth eggs have been recovered yet, so elephant eggs would be used instead. An elephant would also be the surrogate mother for the resulting embryo. The researchers may try a modified SCNT technique used to clone a mouse that had been dead and frozen for 16 years. Ice crystals that form during freezing break up cell membranes, so cells from the frozen mouse were in bad shape. Their DNA was transferred into donor mouse eggs, and cells from the resulting embryos were fused with undifferentiated mouse cells. Four healthy clones were born from the hybrid embryos. What are some of the pros and cons of cloning an extinct animal?arrow_forwardThe ability to selectively modify the genome in the mouse has revolutionized mouse genetics. Outline the procedure for generating a knockout mouse at a specific genetic locus. How can the loxP-Cre system be used to conditionally knock out a gene? What is an important medical application of knockout mice?arrow_forwardIn 1997, Dolly the sheep was cloned by a technique called somatic-cell nuclear transfer (or nuclear-transfer cloning). A nucleus from an adult mammary cell was transferred into an egg from which the nucleus had been removed. The egg was allowed to divide several times in culture, then the embryo was transferred to a surrogate mother who gave birth to Dolly. Dolly died in 2003 after mating and giving birth herself to viable offspring. What does the creation of Dolly tell us about the potential of nuclear material derived from a fully differentiated adult cell? Does the creation of Dolly tell us anything about the potential of an intact, fully differentiated adult cell?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License