BIOLOGY
5th Edition
ISBN: 9781264104680
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11.2, Problem 1CS
Core Skill: Modeling The goal of this modeling challenge is to predict the hydrogen-bonding relationship between O6-MeG and cytosine.
Modeling Challenge: As discussed in Chapter 15, certain chemicals, such as nitrogen mustard and ethyl methanesulfonate, can modify the structures of DNA bases. For example, a methyl group (─CH3) can be attached to the oxygen atom on guanine, thereby creating 6-O-methylguanine (O6-MeG), as shown to the right. When O6-MeG is included in a DNA strand, it can form only two hydrogen bonds with cytosine instead of three. Draw a model for the base pairing between O6-MeG and cytosine.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Original sequence:
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start):
5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’
Question:
4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this?
5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
DNA contents of nitrogenous bases
• %A = %T
%C = %G
• A+G = C+T
%3D
Example: if 35% of the bases of a DNA
-
molecule is thymine what the % of Cyosine?
Using Fig. as a guide, draw the complete structure of a nucleoside triphosphate before and after it becomes incorporated into a polynucleotide chain. Draw the structure that would result if the newly formed phosphodiester bond were hydrolyzed.
Chapter 11 Solutions
BIOLOGY
Ch. 11.1 - Prob. 1CSCh. 11.1 - Prob. 1EQCh. 11.1 - Prob. 2EQCh. 11.1 - CoreSKILL In the experiment of Avery, MacLeod,...Ch. 11.2 - Prob. 1CCCh. 11.2 - Prob. 2CCCh. 11.2 - Core Skill: Modeling The goal of this modeling...Ch. 11.2 - Prob. 2CSCh. 11.3 - If this experiment was conducted for four rounds...Ch. 11.4 - Molecular Mechanism of DNA Replication Concept...
Ch. 11.4 - Prob. 2CCCh. 11.4 - Prob. 3CCCh. 11.4 - Prob. 4CCCh. 11.5 - Prob. 1CCCh. 11.5 - Prob. 1CSCh. 11 - Why did researchers initially believe that the...Ch. 11 - Prob. 2TYCh. 11 - Which of the following equations is accurate...Ch. 11 - Prob. 4TYCh. 11 - Which of the following statements about the...Ch. 11 - Meselson and Stahl were able to demonstrate...Ch. 11 - During replication of a DNA molecule, the daughter...Ch. 11 - Prob. 8TYCh. 11 - A nucleosome is a. a dark-staining body composed...Ch. 11 - The conversion of euchromatin into heterochromatin...Ch. 11 - What are the four key criteria that the genetic...Ch. 11 - A double-stranded DNA molecule contains 560...Ch. 11 - Prob. 3CQCh. 11 - Prob. 1COQCh. 11 - CoreSKILL How might you provide evidence that DNA...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: If 3’ ATTG 5’ is transcribed, the complementary strands is 5’ UAAC 3’ STAMENT 2: Guanine and Cytosine are purine bases ANSWER: STAMENT 1: The general term for the enzyme that connects nucleotide triphosphates in DNA is DNA transferase STAMENT 2: The enzyme that unwinds the double stranded DNA is topoisomerase ANSWER: STAMENT 1: The name of the compound formed when uracil is bonded to ribose is uradine STAMENT 2: The piece of nucleic acid that is complementary to the DNA template and serves as a starting point of replication is called RNA promoter ANSWER:arrow_forwardCompare and contrast the structure of DNA and RNA. Be sure to describe each of the three components of a nucleotide for both DNA and RNA along with the types of bonds formed between the components. In addition, explain: how the nucleotides link together to form each molecule, why the prime ends are labeled 5’ and 3’, what antiparallel is, what phospodiester linkages are and what complementary base pairing is.arrow_forwardInstructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.arrow_forward
- Part II: Information Transfer Background Information - Key Points The background information provided for this lab has given you a general overview of some of 24 the key terms and definitions necessary to understand the transfer of information from gene to protein. The information included below will help you work through the specific problems included in your Tutorial 4 Assignment. When working on the problems remember the base mu to pairing rules (Table 3). Table 3: Rules for nucleotide base pairing. cytosine (C) - guanine (G) adenine (A)- thymine (T) DNA RNA For Transcription: ● ● ● ● cytosine (C) - guanine (G) adenine (A)- uracil (U) Initiation is determined by the recognition of the promoter sequence in the DNA by the RNA polymerase. Stef The transcription start site is downstream of the promoter and is designated as the +1 site. Aspartic acid Alanina Valine Arginine Serine Lysine Asparagine Glutamic TEOPO|0C|AGUCAG|UC|AG/DCAG/3G/ CAGUC UGU A C A Threonine G Methionine Isoleucine…arrow_forwardCompare the DNA binding modes of minor groove binding, intercalating, and crosslinking agents and explain how these interactions give rise to specific pharmaceutical applications. Use the molecular structures of at least one DNA PLEASE DISCUSS THIS IN DETAIL! and correct answers only ! will give good rating! thank you.arrow_forwardTopic: Nucleic Acids (DNA) What are Chargaff’s rules? How do these rules help in elucidating the structure of DNA?arrow_forward
- Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).arrow_forward(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21arrow_forwardTopic: Nucleic Acids (DNA) Explain “the two strands are antiparallel”.arrow_forward
- 1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You can use the one-letter code for valine (V) and do not have to draw the amino acid structure. Label the tRNA and amino acid binding sites on the enzyme. Explain the function of valine-aminoacyl tRNA synthetase and explain why there are 20 related enzymes in every cell.arrow_forwardConsider normal B-form DNA. It forms a regular antiparallel double-helical structure with Watson-Crick base-pairing mediated through hydrogen bonding. The base pairs all stack upon one another, with 3.4 Å spacing between them. DNA strands having a complementary sequence will spontaneously form a double-helix in an aqueous solution. In terms of energy, what primarily drives helix formation? O Positive Entropy from base stacking van der Waals interactions O Hoogsteen interactions Positive Enthalpy from Hydrogen Bonding between GC and AT pairs Negative Enthalpy from Hydrogen Bonding between GC and AT pairs O Negative Entropy from base stackingarrow_forwardGiven the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings and diagrams to describe how the DNA strand will be synthesized into a functional protein.5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’(KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY