BIOLOGY
BIOLOGY
5th Edition
ISBN: 9781264104680
Author: BROOKER
Publisher: MCG
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 11.2, Problem 1CS

Core Skill: Modeling The goal of this modeling challenge is to predict the hydrogen-bonding relationship between O6-MeG and cytosine.

Chapter 11.2, Problem 1CS, Core Skill: Modeling The goal of this modeling challenge is to predict the hydrogen-bonding

Modeling Challenge: As discussed in Chapter 15, certain chemicals, such as nitrogen mustard and ethyl methanesulfonate, can modify the structures of DNA bases. For example, a methyl group (─CH3) can be attached to the oxygen atom on guanine, thereby creating 6-O-methylguanine (O6-MeG), as shown to the right. When O6-MeG is included in a DNA strand, it can form only two hydrogen bonds with cytosine instead of three. Draw a model for the base pairing between O6-MeG and cytosine.

Blurred answer
Students have asked these similar questions
Original sequence:    Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start):  5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’    Question:    4) In a mutant you discovered that the underlined nucleotide has  been deleted. What would the resulting peptide sequence be? What  type of mutation is this?  5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
DNA contents of nitrogenous bases • %A = %T %C = %G • A+G = C+T %3D Example: if 35% of the bases of a DNA - molecule is thymine what the % of Cyosine?
Using Fig. as a guide, draw the complete structure of a nucleoside triphosphate before and after it becomes incorporated into a polynucleotide chain. Draw the structure that would result if the newly formed phosphodiester bond were hydrolyzed.
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
  • Text book image
    Biology (MindTap Course List)
    Biology
    ISBN:9781337392938
    Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
    Publisher:Cengage Learning
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY