BIOLOGY
5th Edition
ISBN: 9781264104680
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 11, Problem 3TY
Which of the following equations is accurate concerning DNA base composition?
- a. %A%T = %G + %C
- b. %A = %G
- c. %A = %G = %T = %C
- d. %A + %G = %T + %C
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Assuming that a strand of DNA is not composed
of equal amounts of A, G, C, and T, which of the
following equations is appropriate when
considering DNA base composition?
O a. %A + %T = %G + %C
b. %A=%T=%G=%C
C. %A + %G=%T + %C
O d. %A = %G
e. %T = %U
you performed a sanger sequencing on a particular segment of DNA. Explain at the molecular level what your gel profile would look like due to this mistake.
a. you forgot to add ddNTPs to your test tube.
b. you added too much ddNTPs to your test tube
This individual's x-ray diffraction data helped to
confirm that DNA was orientied in a helical
structure with uniform diameter.
O a. Rosalind Franklin
b. James Watson
O c. Francis Crick
O d. Gregor Mendel
e. Edwin Chargaff
Chapter 11 Solutions
BIOLOGY
Ch. 11.1 - Prob. 1CSCh. 11.1 - Prob. 1EQCh. 11.1 - Prob. 2EQCh. 11.1 - CoreSKILL In the experiment of Avery, MacLeod,...Ch. 11.2 - Prob. 1CCCh. 11.2 - Prob. 2CCCh. 11.2 - Core Skill: Modeling The goal of this modeling...Ch. 11.2 - Prob. 2CSCh. 11.3 - If this experiment was conducted for four rounds...Ch. 11.4 - Molecular Mechanism of DNA Replication Concept...
Ch. 11.4 - Prob. 2CCCh. 11.4 - Prob. 3CCCh. 11.4 - Prob. 4CCCh. 11.5 - Prob. 1CCCh. 11.5 - Prob. 1CSCh. 11 - Why did researchers initially believe that the...Ch. 11 - Prob. 2TYCh. 11 - Which of the following equations is accurate...Ch. 11 - Prob. 4TYCh. 11 - Which of the following statements about the...Ch. 11 - Meselson and Stahl were able to demonstrate...Ch. 11 - During replication of a DNA molecule, the daughter...Ch. 11 - Prob. 8TYCh. 11 - A nucleosome is a. a dark-staining body composed...Ch. 11 - The conversion of euchromatin into heterochromatin...Ch. 11 - What are the four key criteria that the genetic...Ch. 11 - A double-stranded DNA molecule contains 560...Ch. 11 - Prob. 3CQCh. 11 - Prob. 1COQCh. 11 - CoreSKILL How might you provide evidence that DNA...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In primer designing, which of the following statements is correct? a. Primers should be 18-24 bases in length. b. Base composition should be 45-55% (G+C). c. Melting temperatures between 55-70°C are preferred. d. All choices are correct.arrow_forwardProvide the role of the following in the crude DNA extraction:a. salt b. cold alcohol c. cold distilled water d. blending or blender methode. liquid detergentarrow_forwardUse a drawing to illustrate the principle of DNA gel electrophoresis. Indicate roughly the comparative electrophoretic mobilities of DNAs with 150, 600, and 1200 bp.arrow_forward
- In order to determine the purity of a DNA sample, spectrophotometry can be carried our at Answer to measure DNA, and Answer to measure protein. The choose your answer... ratio is then calculated, and a number between Answer indicates a DNA sample of higher purity. 280nm 1.5 - 2 A280/A260 260nm A260/A280 1.5 - 2 280nm 260nm EA280/A260 A260/A280 260nm 1.5 - 2 A280/A260 280nm A260/280arrow_forwardThe rate of migration of DNA within an agarose gel in the gel electrophoresis technique is dependent on what factor(s)? Select one or more: a. G-C /A-T ratio b. Well size of the gel c. Size of DNA fragment d. Volume of sample loaded e. Negative charge of DNAarrow_forwardWhich of the following relations will be true for the percentage of bases in double-stranded DNA? a. C + T = A + G b. CA = TGarrow_forward
- Overall, a molecule of DNA does not have a positive or negtive charge since the bases are hydrophobic. Select one: True False You loaded a gel with DNA size standards and then 3 different PCR samples. After running the gel until the Bromophenol blue was near the end of the gel, you put the gel under UV light BUT saw no bands at all in any of the 4 lanes on the gel. What could be the problem? a. The DNA fragments must have run off the end of the gel. b. Your PCR reactions did not work. c. All of the answers presented here could be the problem d. The leads (wires) from the power source were placed backwards on the gel unit. e. You forgot to add ethidium bromide to the gel.arrow_forwardWhat happens if you forget to add Sybrsafe to a gel that will be used for DNA gel electrophoresis a. there will only be bands in your sample lanes b.neither the ladder or your sample lanes will have bands c.your ladder lane will be the only one contanining bands d.the gel will run normally and bands will show up for both the ladder lane and the sample lanesarrow_forwardConvert each of the following 3′-to-5′ DNA base sequences to 5′-to-3′ DNA base sequences. a. 3′ ATCG 5′ b. 3′ AATA 5′ c. 3′ CACA 5′ d. 3′ CAAC 5′arrow_forward
- Determine which primer pair is the best choice. Explain why the other primers are not good choices. Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best. Forward 1: Reverse 1: Forward 2: Reverse 2: Forward 3: Reverse 3: Forward 4: Reverse 4: Forward 5: Reverse 5: Forward 6: Reverse 6: Forward 7: Reverse 7: Forward 8: Reverse 8: Forward 9: Reverse 9: 5' gaaataattttgtttaactttaag 3' Tm= 5' gtttaagacaaaatagtctgg 3' Tm = 5' gtaactcagetttcaggtcg 3¹ 5' tctcggaatgttgcaacage 3¹ 5' agattageggatcctacctg 3' 5' atgtgtaatcccagcagcag 3¹ Tm= Tm= Tm= Tm = 5' cattgattatttgcacggcg 3' Tm= 5' aaaatettctctcatccgcc 3' Tm= 5' tccataagattagcggatce 3' Tm= 5' tgcaagettggetgttttgg 3² Tm= 5' gatectacctgacgcttttta 3' Tm= 5' aaataatgaattegagctcggt 3' Tm= 5'ataaaaaaatcgagataaccgtt 3' Tm = 5'aggtcgactctagaggate 3' Tm= 5' tccataagattagcggatce 3' 5' tctcgcatgggggaccccac 3' 5'ctacctgttccatggccaac 3' Tm= 5' ttcgggcatggcactcttg 3² Tm= Tm= Tm =arrow_forwardYou have a 20 mg/ml of Ethidium bromide stock solution. You need to a final concentration of 2ug/ml into a Agarose solution to visualize DNA. What is the dilution factor? Give typing answer with explanation and conclusionarrow_forwardWhat are the roles of the following reagents in DNA extraction? a. Ethanol b. NaCl c. SDS d. TE buffer e. EDTAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA Use In Forensic Science; Author: DeBacco University;https://www.youtube.com/watch?v=2YIG3lUP-74;License: Standard YouTube License, CC-BY
Analysing forensic evidence | The Laboratory; Author: Wellcome Collection;https://www.youtube.com/watch?v=68Y-OamcTJ8;License: Standard YouTube License, CC-BY