Gen Combo Ll Biology; Connect W/learnsmart Labs Access Card
4th Edition
ISBN: 9781259853197
Author: Robert Brooker
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 11.4, Problem 2CC
Summary Introduction
To explain: The strand out of leading and lagging strands that are made discontinuously in the direction opposite to the movement of the replication fork.
Introduction: DNA stands for “Deoxyribonucleic acid”. It is a
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What is replication slippage?
What is the difference between the leading strand and the lagging strand in DNA replication?
There are different DNA polymerases involved in elongation of the leading strand and the lagging strand.
The leading strand is synthesized continuously in the 5' → 3' direction, while the lagging strand is synthesized discontinuously in the 5' → 3' direction.
The leading strand requires an RNA primer, whereas the lagging strand does not.
The leading strand is synthesized in the 3' → 5' direction in a discontinuous fashion, while the lagging strand is synthesized in the 5' → 3' direction in a continuous fashion.
How many replication forks are formed at the origin of replication?
Chapter 11 Solutions
Gen Combo Ll Biology; Connect W/learnsmart Labs Access Card
Ch. 11.1 - Prob. 1BCCh. 11.1 - Prob. 1EQCh. 11.1 - Prob. 2EQCh. 11.1 - CoreSKILL In the experiment of Avery, MacLeod,...Ch. 11.2 - Prob. 1CCCh. 11.2 - Prob. 2CCCh. 11.2 - Prob. 3CCCh. 11.2 - Prob. 4CCCh. 11.3 - If this experiment was conducted for four rounds...Ch. 11.4 - Molecular Mechanism of DNA Replication Concept...
Ch. 11.4 - Prob. 2CCCh. 11.4 - Prob. 3CCCh. 11.4 - Prob. 4CCCh. 11.5 - Prob. 1CCCh. 11.5 - Prob. 2CCCh. 11.5 - Prob. 1BCCh. 11 - Why did researchers initially believe that the...Ch. 11 - Prob. 2TYCh. 11 - Which of the following equations is accurate...Ch. 11 - Prob. 4TYCh. 11 - Which of the following statements about the...Ch. 11 - Meselson and Stahl were able to demonstrate...Ch. 11 - During replication of a DNA molecule, the daughter...Ch. 11 - Prob. 8TYCh. 11 - A nucleosome is a. a dark-staining body composed...Ch. 11 - The conversion of euchromatin into heterochromatin...Ch. 11 - What are the four key criteria that the genetic...Ch. 11 - A double-stranded DNA molecule contains 560...Ch. 11 - Prob. 3CQCh. 11 - Prob. 1COQCh. 11 - CoreSKILL How might you provide evidence that DNA...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If deoxyribonucleotides that lack the 3’-OH groups are added during the replication process, what do you expect will occur?arrow_forwardWhy can’t the lagging strand be synthesized in the same direction of the replication fork?arrow_forwardIn terms of the new DNA strands that are generated, what are the differences between replication and conventional polymerase chain reaction?arrow_forward
- What is the end-replication problem? Why, in the absence of telomerase, do the ends of linear chromosomes get progressively shorter each time the DNA is replicated?arrow_forwardThe sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forwardWhether the statement "In a replication bubble, the same parental DNA strand serves as the template strand for leading strand synthesis in one replication fork and as the template for lagging-strand synthesis in the other fork" is true or false.arrow_forward
- DNA polymerases are processive, which means that they remain tightly associated with the template strand while moving rapidly and adding nucleotides to the growing daughter stand. Which piece of the replication machinery accounts for this characteristic? Helicase Sliding Clamp Single Stranded Binding Protein Primasearrow_forwardDNA polymerase occasionally incorporates the wrong nucleotide during DNA replication. If left unrepaired, the base-pair mismatch that results will lead to mutation in the next replication. As part of a template strand, the incorporated wrong base will direct the incorporation of a base complementary to itself, so the bases on both strands of the DNA at that position will now be different from what they were before the mismatch event. The MER-minus strain of yeast does not have a functional mismatch excision repair system, but it has normal base excision repair and nucleotide excision repair systems. Which of the following statements is correct about differences in the mutation spectrum between MER-minus and wildtype yeast? More than one answer is correct. Options: More point mutations will arise in MER-minus yeast. Fewer point mutations will arise in MER-minus yeast as compared with wildtype. Of the total point mutations that…arrow_forwardWhat does DNA polymerase need in order to make contact with a replication origin?arrow_forward
- (d) Write down the sequences of the templates that would give the tetranucleotides shown in I and II. In each case, label the 5' and 3' ends and indicate which template base is used first. (e) What difference would it make to bidirectional DNA replication if both modes of chain extension were equally favourable? I IIarrow_forwardLagging strand: is synthesized discontinuously in the replication fork. direction toward the N terminal to the C terminal From the nitrogenous base to the phosphate group 5-> 3' 3'-> 5 direction toward the Leading strand: is synthesized continuously in the replication fork. N terminal to the C terminal From the nitrogenous base to the phosphate group 5-> 3' O 3'-> 5' How would the DNA sequence GCTATA be transcribed to MRNA? GCUAUA CGATAT CGAUAU O GCUTUT What bases would be found on the other strand of the DNA sequence GCTATA ? GCUAUA CGATAT CGAUAU GCUTUT O O O O O OO OOarrow_forwardWhat mechanism was originally proposed as one of the three models for DNA replication? What is the name given to the short stretches of DNA formed on the lagging strand? How can these short fragments be initiated?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY