Concept explainers
In bacteriophages and bacteria, the DNA is almost always organized into circular (closed loops) chromosomes. Phage λ is an exception, maintaining its DNA in a linear chromosome within the viral particle. However, as soon as this DNA is injected into a host cell, it circularizes before replication begins. What advantage exists in replicating circular DNA molecules compared to linear molecules, characteristic of eukaryotic chromosomes?
HINT: This problem involves cm understanding of eukaryotic
To explain: The advantages of replication of DNA in a circular form compared to the linear form.
Introduction: In almost all the organisms, DNA is the genetic material that is inherited from one generation to the next. Depending on the species, DNA exists as a linear or circular molecule. In bacterial species, almost always, DNA is present as a circular chromosome. Viruses contain either DNA or RNA as their genetic material.
Explanation of Solution
In bacterial species, DNA is mostly present in circular form rather than linear form. Circular DNA serves certain advantages over the linear form. Some of the advantages of circular DNA over linear DNA are as follows:
- Circular DNA molecules are more stable compared to the linear molecules.
- End regions of linear DNA are more prone to degradation by intracellular enzymes.
- Linear DNA molecules have an unprotected OH group. This increases the chances of chemical degradation of linear DNA molecules.
- Circular DNA does not show DNA loss, as seen in linear DNA molecules. Linear DNA has telomerase, which shortens after every cell cycle.
Thus, circular DNA is more advantageous than linear DNA because it is more stable than the linear DNA molecules.
Want to see more full solutions like this?
Chapter 12 Solutions
Concepts Of Genetics, Books A La Carte Edition; Modified Masteringgenetics With Pearson Etext -- Valuepack Access Card -- For Concepts Of Genetics (11th Edition)
- In bacterial cells, nucleotide excision repair involves which of the following proteins? DNA glycosylase AP endonuclease photolyase AlkB UvrABC proteins If Meselson and Stahl had results from density gradient analysis of bacterial DNA that indicated only two bands, one of the original density and one that was the same as unlabeled DNA, and no intermediate density band, this would indicate that DNA replication is: constructive semiconservative conservative consecutive cannot determine from the information given 6.In E. coli, which DNA polymerase is primarily responsible for filling in the gaps in the DNA generated during nucleotide excision repair? DNA polymerase I DNA polymerase II DNA polymerase IV DNA polymerase V none of the abovearrow_forwardMost prokaryotes have a circular chromosome, with no ends, so the shortening of DNA does not occur. But what protects the genes of linear eukaryotic chromosomes from being eroded away during successive rounds of DNA replication?arrow_forwardAflatoxin B1 is a highly mutagenic and carcinogenic compound produced by certain fungi that infect crops such as peanuts. Aflatoxin is a large, bulky molecule that chemically bonds to the base guanine (G) to form the aflatoxin-guanine adduct that is pictured below. In the figure below, the aflatoxin is orange, and the guanine base is purple. This adduct distorts the DNA double helix and blocks replication. a. What type(s) of DNA repair system is (are) most likely to be involved in repairing the damage caused by exposure of DNA to aflatoxin B1? b, Recent evidence suggests that the adduct of guanine and aflatoxin B1 can attack the bond that connects it to deoxyribose; this liberates the adducted base, forming an apurinic site. How does this new information change your answer to part (a)?arrow_forward
- Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…arrow_forwardhe Meselson and Stahl experiment provided conclusive evidence for the semiconservative replication of DNA in E. coli. What pattern of bands would they have observed in a CsCl gradient after one generation if replication was conservative? a heavy, a light and an intermediate band one heavy and one light band (no intermediate) one intermediate band one light band one heavy bandarrow_forwardDNA polymerase occasionally incorporates the wrong nucleotide during DNA replication. If left unrepaired, the base-pair mismatch that results will lead to mutation in the next replication. As part of a template strand, the incorporated wrong base will direct the incorporation of a base complementary to itself, so the bases on both strands of the DNA at that position will now be different from what they were before the mismatch event. The MER-minus strain of yeast does not have a functional mismatch excision repair system, but it has normal base excision repair and nucleotide excision repair systems. Which of the following statements is correct about differences in the mutation spectrum between MER-minus and wildtype yeast? More than one answer is correct. Options: More point mutations will arise in MER-minus yeast. Fewer point mutations will arise in MER-minus yeast as compared with wildtype. Of the total point mutations that…arrow_forward
- Three common ways to repair changes in DNA structure are nucleotideexcision repair, mismatch repair, and homologous recombination repair. Which of these three mechanisms would be used to fix the following types of DNA changes?A. A change in the structure of a base caused by a mutagen in anondividing eukaryotic cellB. A change in DNA sequence caused by a mistake made by DNApolymeraseC. A thymine dimer in the DNA of an actively dividing bacterial cellarrow_forwardWhich of the following processes of genetic information flow can occur under lab conditions, but has never been observed to occur under natural conditions (either in living cells or in viruses)? transcription of RNA from a DNA template (using DNA-dependent-RNA-polymerase) self-replication of RNA from an RNA template (using RNA-dependent-RNA-polymerase) direct-translation of protein from a DNA template (using special ribosomes) self-replication of DNA from a DNA template (using DNA-dependent-DNA-polymerase) translation of protein from an RNA template (using ordinary ribosomes)arrow_forwardWhat enzymatic features of DNA polymerase prevent it from replicating one of the DNA strands at the ends of linear chromosomes? Compared with DNA polymerase, how is telomerase different in its ability to synthesize a DNA strand? What does telomerase use as its template for the synthesis of a DNA strand? How does the use of this template result in a telomere sequence that is tandemly repetitive?arrow_forward
- What are some of the ways that organisms use to ensure the fidelity of DNA replication? Why is it important that the fidelity of DNA replication is an evolutionary balance between faithful replication and the existence of some errors? Escherichia coli and other bacteria methylate adenines on the original strand to distinguish the original strand from the newly replicated strand of DNA. Why is this distinction important?arrow_forwardHuman Fbh1 helicase is important in the process of DNA replication. When a mutation occurs during the production of Fbh1, the result is a mutant Fbh1 that binds at the replication fork and prevents any helicase protein from attaching to the strand. Based on this information and the image shown, what would happen during DNA replication if this mutant helicase were present? A - Topoisomerase would unwind the DNA and an RNA primer would attach to the DNA molecule and initiate replication. The process would then stop at the blue triangle because helicase is needed to separate the strands of DNA. B - Topoisomerase would unwind the DNA, but then the process would stop at the blue triangle because helicase, the RNA primer, would not be able to attach to the DNA molecule and initiate replication. C - The process would begin at the blue triangle when topoisomerase unwinds the DNA and an RNA primer attaches to the DNA molecule and initiates replication. DNA polymerase would begin the synthesis…arrow_forwardA circular molecule of DNA contains 1 million base pairs. If the rate of DNA synthesis at a replication fork is 100,000 nucleotides per minute, how much time will theta replication require to completely replicate the molecule, assuming that theta replication is bidirectional? How long will replication of this circular chromosome by rolling-circle replication take? Ignore replication of the displaced strand in rolling-circle replication.arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education