bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 12, Problem 1NST

In bacteriophages and bacteria, the DNA is almost always organized into circular (closed loops) chromosomes. Phage λ is an exception, maintaining its DNA in a linear chromosome within the viral particle. However, as soon as this DNA is injected into a host cell, it circularizes before replication begins. What advantage exists in replicating circular DNA molecules compared to linear molecules, characteristic of eukaryotic chromosomes?

HINT: This problem involves cm understanding of eukaryotic DNA replication, as discussed earlier in the text (see Chapter 11). The key to its solution is to consider why the enzyme telomerase is essential in eukaryotic DNA replication, and why bacterial and viral chromosomes can be replicated without encountering the “telomere” problem.

Expert Solution & Answer
Check Mark
Summary Introduction

To explain: The advantages of replication of DNA in a circular form compared to the linear form.

Introduction: In almost all the organisms, DNA is the genetic material that is inherited from one generation to the next. Depending on the species, DNA exists as a linear or circular molecule. In bacterial species, almost always, DNA is present as a circular chromosome. Viruses contain either DNA or RNA as their genetic material.

Explanation of Solution

In bacterial species, DNA is mostly present in circular form rather than linear form. Circular DNA serves certain advantages over the linear form. Some of the advantages of circular DNA over linear DNA are as follows:

  • Circular DNA molecules are more stable compared to the linear molecules.
  • End regions of linear DNA are more prone to degradation by intracellular enzymes.
  • Linear DNA molecules have an unprotected OH group. This increases the chances of chemical degradation of linear DNA molecules.
  • Circular DNA does not show DNA loss, as seen in linear DNA molecules. Linear DNA has telomerase, which shortens after every cell cycle.
Conclusion

Thus, circular DNA is more advantageous than linear DNA because it is more stable than the linear DNA molecules.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
During DNA replication in E. coli, which enzyme forms the phosphodiester bond between an RNA primer and the first incoming deoxyribonucleotide for an Okazaki fragment on the lagging strand?  topoisomerase DNA polymerase III DNA helicase DNA polymerase II DNA ligase Heterogeneous nuclear RNA is typically characterized by which of the following features? it is more common in prokaryotes than in eukaryotes it contains introns, but no exons it contains more exons than introns it contains exons, but no introns it contains more introns than exons
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side
. Which of the following enzymes can break, and rejoin, phosphodiester bonds during the normal DNA replication process in the chromosomes of E. coli cells? single-stranded binding proteins RNA polymerase topoisomerase DNA helicase DNA ligase      The mutation causing sickle-cell anemia in humans, which changes the normal T to an A in the sixth codon (substituting valine for glutamic acid), occurs in which gene of the hemoglobin family? the a-globin gene (alpha) the b-globin gene (beta) the g-globin gene (gamma) the d-globin gene (delta) the e-globin gene (epsilon)       The hypermutable condition, which allows cells to “play the lottery” by lowering the fidelity of DNA replication, was first discovered in which of the following prokaryotes? Saccharomyces cerevisiae Amoeba dubia Drosophila melanogaster Homo sapiens Escherichia coli

Chapter 12 Solutions

Concepts Of Genetics, Books A La Carte Edition; Modified Masteringgenetics With Pearson Etext -- Valuepack Access Card -- For Concepts Of Genetics (11th Edition)

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY