EBK ESSENTIALS OF GENETICS
9th Edition
ISBN: 8220102741614
Author: Palladino
Publisher: YUZU
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 12, Problem 21PDQ
One form of posttranscriptional modification of most eukaryotic RNA transcripts is the addition of a poly-A sequence at the 3'-end. The absence of a poly-A sequence leads to rapid degradation of the transcript Poly-A sequences of various lengths are also added to many prokaryotic RNA transcripts where, instead of promoting stability, they enhance degradation. In both cases, RNA secondary structures, stabilizing proteins, or degrading enzymes interact with poly-A sequences. Considering the activities of RNAs, what might be the general functions of 3'-polyadenylation?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
In eukaryotes there is not a consistent relationship between the length of the coding sequence of a gene and the length of the mature mRNA it encodes, even though one nucleotide in DNA = one nucleotide in pre-mRNA or primary transcript. Explain why this is so.
Many genes in both bacteria and eukaryotes contain numerous sequences that can cause pauses in or premature termination of transcription. Nevertheless, the transcription of these genes within a cell normally produces multiple RNA molecules thousands of nucleotides long without pausing or premature termination. However, when a single round of transcription of these genes takes place in a test tube, RNA synthesis is frequently interrupted by pauses and premature terminations, which reduce the rate at which transcription takes place and frequently shorten the lengths of the mRNA molecules produced. Most pauses and premature terminations occur when RNA polymerase temporarily backtracks (i.e., backs up) for one or two nucleotides along the DNA. Experimental findings have demonstrated that most pauses and premature terminations disappear if several RNA polymerases are simultaneously transcribing the DNA molecule. Propose an explanation for this observation of faster transcription and longer…
With several molecular biology techniques, researchers identified that the intertwined sequence could be naturally transcribed using a promoter located 13 kilobases upstream that of p16INK4A. In addition, the transcription of this gene results in a primary transcript that is read in a different reading frame and is alternatively spliced compared to the transcript of p16INK4A. The resulting protein has been called ARF (Alternative Reading Frame). In your own words and with a diagram, describe the DNA, RNA and proteins encoded in this region.
Chapter 12 Solutions
EBK ESSENTIALS OF GENETICS
Ch. 12 - CASE STUDY | A drug that sometimes works A...Ch. 12 -
CASE STUDY | A drug that sometimes works
A...Ch. 12 -
CASE STUDY | A drug that sometimes works
A...Ch. 12 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 12 - Review the Chapter Concepts list on p. 215. These...Ch. 12 - In studies of frameshift mutations, Crick,...Ch. 12 -
4. The mRNA formed from the repeating...Ch. 12 - In studies using repeating copolymers, AC......Ch. 12 - Prob. 6PDQCh. 12 - Prob. 7PDQ
Ch. 12 -
8. When the amino acid sequences of insulin...Ch. 12 - Prob. 9PDQCh. 12 - Why doesn't polynucleotide phosphorylase (Ochoa's...Ch. 12 - Refer to Table 12.1. Can you hypothesize why a...Ch. 12 -
12. Predict the amino acid sequence produced...Ch. 12 - A short RNA molecule was isolated that...Ch. 12 - A glycine residue exists at position 210 of the...Ch. 12 - Shown here is a theoretical viral mRNA sequence...Ch. 12 -
16. Most proteins have more leucine than...Ch. 12 - Define the process of transcription. Where does...Ch. 12 - Describe the structure of RNA polymerase in...Ch. 12 - In a written paragraph, describe the abbreviated...Ch. 12 - Messenger RNA molecules are very difficult to...Ch. 12 - One form of posttranscriptional modification of...Ch. 12 - In a mixed copolymer experiment, messages were...Ch. 12 -
23. Shown in this problem are the amino acid...Ch. 12 - Alternative splicing is a common mechanism for...Ch. 12 - The genetic code is degenerate. Amino acids are...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- For a specific type of mutation at a given location in a particular gene, identify whether it will affect the size of the mRNA, the protein, or both. How would the mutant appear on a gel in comparison to the originalarrow_forwardWhat is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence: 5′–GGCAUGCAUUACGGCAUCACACUAGGGAUC–3′ What is the sequence of the template and coding strands of the DNA that encodes this RNA? On which side (5′ or 3′) of the template strand is the promoter located?arrow_forwardShown below is a schematic drawing of a gene, with the transcription unit divided into numbered regions. The arrows (;) indicate transcription initiation sites, "D" indicates a splice donor site, "A" indicates a splice acceptor site, and "An" indicates a polyadenylation signal. Give all the possible fully processed mRNAs that could be produced from transcripts of this gene (you don't need to draw anything, just list the regions that would be included in each mRNA by number).arrow_forward
- Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.arrow_forwardShown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?arrow_forwardNonfunctional HexA protein is responsible for the autosomal recessive disease Tay Sachs. A patient with Tay Sachs produces a normal amount of full length but non-functional HexA protein. Of the choices below, what is the most likely type of mutation responsible for the disease? a) base substitution in an intron 5' splice site b) frameshift in an exon c) missense in an exon d) base substitution in an enhancer regionarrow_forward
- The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never madearrow_forwardSelect the three post-transcriptional modifications often seen in the processing of mRNA in eukaryotes: Group of answer choices heteroduplex formation; base modification; capping 3'-capping; 5'-poly(A) tail addition; splicing 5'-poly(A) tail addition; insertion of introns; capping removal of exons; insertion of introns; capping 5'-capping; 3'-poly(A) tail addition; splicingarrow_forwardSeveral examples of antisense RNA regulating translation in bacterial cells have been discovered. Molecular geneticists have also used antisense RNA to artificially control transcription in both bacterial and eukaryotic genes. If you wanted to inhibit the transcription of a bacterial gene with antisense RNA, what sequences might the antisense RNA contain?arrow_forward
- Although the genetic code is universal, a few organisms such as Paramecium have a slightly modified version in which UGA, a stop codon for most organisms, codes for tryptophan in Paramecium. Suppose that the researcher wanted to make an in vitro translation system using all of the components from Paramecium. Which of the components, if any, would she need to replace in order to have an in vitro system that was universal? Possible Answers: A. She would need to leave out the P site. B. She would need to leave out the termination factor proteins. C. She would need to leave out the tRNA that recognizes UGA. D. She would need to leave out the ubiquitinarrow_forwardWhen a region of DNA that contains the genetic information for a protein is isolated from a bacterial cell and inserted into a eukaryotic cell in a proper position between a promoter and a terminator, the resulting cell usually produces the correct protein. But when the experiment is done in the reverse direction (eukaryotic DNA into a bacterial cell), the correct protein is often not produced. Can you suggest an explanation?arrow_forwardA full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete promoter, a wildtype nucleotide sequence and a polyadenylation sequence. However, the gene does not produce a functional protein. Students may submit their answers as bullet points or a table to facilitate grading. Part A: List up to five reasons why this gene is not expressed in E. coli. Part B: What changes do you recommend that would facilitate expression of the eukaryotic gene in E. coli.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license