BIOLOGY-TEXT
5th Edition
ISBN: 9781260169621
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 12.2, Problem 1CS
Core Skill: Connections Look back at the role of DNA polymerase shown in Figure 11.15. What are similarities and differences between the function of DNA polymerase and that of RNA polymerase?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Objective: Get a sense of how genomics, the study of the genome in its entirety,needs to think about how to go about its research.
Geonomic DNA is broken up into fragments. The 5’ and 3’ ends of each fragment(a “read”) are sequenced. The sequenced reads are assembled together intocontiguous sequences (“contigs”) based on sequence similarity.
The idea is to sequence enough random fragments so that every nucleotide in thegenome is represented on some read. The number of such fragments needed iscalled the coverage, c.
The coverage c can be calculated by the formula RL/G, where R is the number ofreads sequenced, L is the average length of a read and G is the total length of thegenome. The units of length are bases (b) or base pairs (bp).
Consider a genome whose length is 1000 bp. “Shotgun” sequencing techniquesare applied to the genome, resulting in 20 reads, with an average length of 50 bp.A very important point is that, even though 20 x 50 = 1000, there is no guaranteethat ALL…
Protein Synthesis and Mutation Practice
• Complete the lines below by determining the mRNA transcript and amino acid sequence.
• Compare the mutant DNA strands to the wild type strand.
⚫ Circle the mutation in the mutant DNA strands and describe the type of mutation (frameshift -
insertion, frameshift - deletion, point - missense, point - silent, or point-nonsense). Not all of these will
be used in this assignment!
Wild type DNA template: 3' TACGCGTGCACGATGCAGTAGTACATC5'
mRNA transcript sequence:
Amino acid sequence:
Mutation #1 DNA template: 3' TACGCGTGCACGATCCAGTAGTACATC5'
mRNA transcript sequence:
Amino acid sequence:
Type of mutation:
Mutation #2 DNA template: 3' TACGCGTGCTCGATGCAGTAGTACATC5'
mRNA transcript sequence:
Amino acid sequence:
Type of mutation:
TOPIC: PCR and Gene Cloning Basics
Question: What are 2 possible roles of CaCl2 in the transformation process?
Chapter 12 Solutions
BIOLOGY-TEXT
Ch. 12.1 - What disease would result if a person inherited...Ch. 12.1 - Prob. 2CCCh. 12.1 - What is the direction of flow of genetic...Ch. 12.2 - Core Skill: Connections Look back at the role of...Ch. 12.3 - Prob. 1CCCh. 12.4 - Prob. 1CCCh. 12.4 - Prob. 1EQCh. 12.4 - Prob. 2EQCh. 12.4 - Prob. 3EQCh. 12.5 - Core Skill: Connections Look back at Figure 6.3,...
Ch. 12.5 - Prob. 2CSCh. 12.6 - Prob. 1CCCh. 12 - Which of the following best represents the central...Ch. 12 - A mutation prevents a gene from being transcribed...Ch. 12 - Prob. 3TYCh. 12 - Prob. 4TYCh. 12 - If a eukaryotic mRNA failed to have a cap attached...Ch. 12 - Prob. 6TYCh. 12 - Prob. 7TYCh. 12 - During the initiation of translation, the first...Ch. 12 - Prob. 9TYCh. 12 - Prob. 10TYCh. 12 - Prob. 1CQCh. 12 - Prob. 2CQCh. 12 - Prob. 3CQCh. 12 - Prob. 1COQCh. 12 - Prob. 2COQ
Additional Science Textbook Solutions
Find more solutions based on key concepts
More than one choice may apply. Using the terms listed below, fill in the blank with the proper term. anterior ...
Essentials of Human Anatomy & Physiology (12th Edition)
Sea turtles have disappeared from many regions, and one way of trying to save them is to reintroduce them to ar...
MARINE BIOLOGY
a. What three lineages of lobe-fins survive today? b. Go back to the phylogenetic tree in Interactive Question ...
Study Guide for Campbell Biology
Why is it necessary to be in a pressurized cabin when flying at 30,000 feet?
Anatomy & Physiology (6th Edition)
Your bore cells, muscle cells, and skin cells look different because a. different kinds of genes are present in...
Campbell Essential Biology (7th Edition)
2. A gene is a segment of DNA that has the information to produce a functional product. The functional product ...
Genetics: Analysis and Principles
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Expand PCR? Describe the different Steps involved in this technique?arrow_forwardMacmillan Learning What factors promote the fidelity of replication during synthesis of the leading strand of DNA? removal of the RNA primers between Okazaki fragments by DNA polymerase I breaks that occur in the leading strand are repaired by DNA ligase prevention of mismatched nucleotides at the replication fork by topoisomerase removal of wrongly inserted nucleotides by the 3'-exonuclease activity of DNA polymerase III Watson-Crick base pairing between the template and leading strand Incorrectarrow_forwardHow does proofreading improve replication fidelity?arrow_forward
- VISUAL SKILLS If the DNA pol I in a given cell werenonfunctional, how would that affect the synthesis ofa leading strand? In the overview box in Figure 16.17,point out where DNA pol I would normally function onthe top leading strand.arrow_forwardHome Work: • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5' -СТАССТСCGGGTTGACTGСТАССТТССССGGATGCCCAAAAТТСТСGAG-3— :::::::::::: :::::::::::: :::: +3'-GATGGACССССААСТGACGATGGAAGGGCCCТАССGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is happening at each step. (1) température cycle #1arrow_forwardPractice: DNA Structure and Replication 1. Label each part of the model to the right. Include specific nitrogen base pairs in your labeling. 2. What molecule is it? 3. What is its purpose? 4. Where can it be found in a prokaryotic cell? 5. Where can it be found in a eukaryotic cell? 6. It gets copied during a process called replication. When does this happen? 7. What is the result of DNA replication? 8. Why is DNA replication necessary? 10. What would the chromosome to the right look like after DNA replication? 11. What would the chromosome to the right be called after DNA replication? 9. Why is DNA replication said to be semi-conservative? Draw a picture to support your answer. TAACCGAGTTCAGA b. TTAACCGAGTTCAGA Genetics Unit Sol Sol Dal 12. Replicate the following four DNA strands using what you know about complementary base pairs. TACOTCCAGATITT a. AATACGTCCAGATTTT c. CCCGCGGAATATACA O book It's Not Rocket Science 2016 d. AGGGCTACTTCAGAC J 7arrow_forward
-  Proofreads each nucleotide its template as soon as it is added to the growing strand. A) DNA Ligase B) Helicase C) DNA Polyerase D) Primase The genetic code A) has no redundancy but does have ambiguity B) has both redundancy and ambiguity C) has redundancy and not ambiguity D) has ambiguity E) has redundancyarrow_forwardHow did the ability to distinguish old and newly synthesized DNA strands enable Meselson and Stahl to verify that DNA replication is semiconservative?arrow_forwardProject: You want to make a cat that glows in the dark (its nose, ears, and tail should glow). Choose the best answer. 9) To get started on this project, you isolate and cut out the gene in a jellyfish that codes for the green fluorescent protein (GFP). The next thing you need to do is attach this gene to the correct promoter so that you can be sure it is expressed appropriately in the cat. Which of the following promoters should you use? a) any promoter is fine b) the original promoter found in the jellyfish c) a promoter from a gene that is expressed in cells of the cat's nose, ears, and tail 10) You are now ready to transfer the piece of recombinant DNA you have prepared to the cat. You want to be sure that the transgenic cat you create will be able to pass the fluorescence on to its offspring. What is the best type of cell to transfer the recombinant DNA to? a) an unfertilized egg b) a fertilized egg c) somatic cells of an adult catarrow_forward
- Provide five advantages of Next Generation Sequencing? and explain each of these advantages.arrow_forwardCompare the possible differences between a eukaryotic protein-encoding gene cloned by PCR and the same gene cloned by reverse transcriptase PCR (RTPCR).arrow_forwardExperiment A microarray was hybridized with a mixture of two differentially labeled fluorescent cDNAs, one prepared using retinal RNA of 1-day-old mice (labeled with a green fluorescent dye) and the other prepared using retinal RNA of 28-day-old mice (red fluorescence). The two probes were prepared from identical amounts of retinal tissues and were mixed together for hybridization to the microarray. Unhybridized probes were washed away, and the microarray was photographed in a fluorescence microscope.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License