Biology: Life on Earth Plus Mastering Biology with Pearson eText -- Access Card Package (11th Edition)
11th Edition
ISBN: 9780134153742
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13, Problem 5FTB
Summary Introduction
To review:
The given blank space in the statement, “translation begins with the codon of messenger ribonucleic acid (mRNA) and continues until a(n) __________________ codon is reached. Individual amino acids are brought to the ribosome by ___. These amino acids are linked into protein by bonds.”
Introduction:
There are three processes, namely replication, transcription, and translation that take place in the cell and helps in the continuity of the life. Translation is the final step of converting the mRNA into the amino acids, which forms the proteins. The transfer RNA (tRNA) molecules help in the amino acids generation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Translation begins with the_______ codon of mRNAand continues until a(n)_______ codon is reached. Individual amino acids are brought to the ribosome by______. These amino acids are linked into protein by _______bonds.
During the initiation of translation, the ribosome assembles on an mRNA strand with the start codon (AUG) positioned at the ____________ site, and the next codon positioned at the _____________ site.
In translation of an mRNA into a protein, the first amino acid that is attached to the start codon is which of the following?
a. O-formylmethionine
b. Serine
c. N-formylmethione
d. Cysteine
Chapter 13 Solutions
Biology: Life on Earth Plus Mastering Biology with Pearson eText -- Access Card Package (11th Edition)
Ch. 13 - 1. The molecule that carries the genetic...Ch. 13 - 2. Which of the following is not true of...Ch. 13 - 3. A stop codon
a. signals the end of protein...Ch. 13 - Prob. 4MCCh. 13 - Epigenetic modification of gene expression a....Ch. 13 - Prob. 1FTBCh. 13 - The three types of RNA that are essential for...Ch. 13 - 3. The genetic code uses______ (how many?) bases...Ch. 13 - The enzyme_______ synthesizes RNA from the...Ch. 13 - Prob. 5FTB
Ch. 13 - Prob. 6FTBCh. 13 - How does RNA differ from DNA?Ch. 13 - Prob. 2RQCh. 13 - Define the following terms: genetic code, codon,...Ch. 13 - 4. How is mRNA formed from a eukaryotic gene?
Ch. 13 - 5. Diagram and describe protein synthesis.
Ch. 13 - 6. Explain how complementary base pairing is...Ch. 13 - 7. Describe the principal mechanisms of regulating...Ch. 13 - Define mutation. Describe four different effects...Ch. 13 - Many years ago, some researchers reported that...Ch. 13 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In which of the following would you find the start codon sequence of a gene? mRNA DNA and mRNA mRNA and protein DNA, mRNA and protein Proteinarrow_forwardDuring translation, the ribosome binds to ____ end of the mRNA and translation will proceed in the ____ directionarrow_forwardWhat term is used to describe the sequence on the tRNA that is complementary to mRNA? Complementary sequence Codon Anti-codon Anti-anticodonarrow_forward
- If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA transcription and translation what would be the amino acid sequence of the product?arrow_forwardTranslation is a process which is best symbolized by a. RNA --> DNA b. DNA --> RNA c. DNA --> protein d. RNA --> protein e. Protein --> RNAarrow_forwardA DNA strand with the sequence 3’ AACGTAACG 5’ is transcribed. What is the sequence of the mRNA molecule? 5’ AACGTAACG 3’ 5’ UUGCAUUGC 3’ 5’ TTGCATTGC 3’ 5’ UUGCAUUGC 3’arrow_forward
- Explain the process translation. A complete answer will include the words below tRNA, amino acid, polypeptide chain, ribosome, mRNA, codon, anticodon, nucleotides, base pairing rules, sequencearrow_forwardA ribosome binds to the following mRNA at the site indicatedby the dark box. At which codon will translation begin?5′ ■ GCCGGAAUGCUGCUGGCa) GCC b) GGCc) AUG d) AAUarrow_forwardWhich of the following steps in protein synthesis does not require a direct supply of energy? a. proofreading step by certain aminoacyl-tRNA synthetases b. translocation of mRNA in a ribosome c. linkage of an amino acid to its cognate tRNA d. alignment of a tRNA anticodon with an mRNA codonarrow_forward
- during translation, each codon on the mRNA complementary base pairs with an snticodon on......arrow_forwardUse the codon sequence to translate the following mRNA sequence (start with the start codon - AUG - codes for methionine): mRNA sequence - AUGUAUAAGUAA [ Choose ] methionine, lysine, Stop, tyrosine 1st codon 2nd codon 3rd codon 4th codonarrow_forwardTranscribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: C G A T A C A A T G G A C C C G G T A T G C G A T A T C C mRNA: Codon: Anitcodon: Amino Acids:arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY