Biology: Life on Earth Plus Mastering Biology with Pearson eText -- Access Card Package (11th Edition)
11th Edition
ISBN: 9780134153742
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13, Problem 4MC
Summary Introduction
Introduction:
Deoxyribonucleic acid (DNA) contains nitrogenous bases, which pair with one another according to their chemical structure. Same goes for the ribonucleic acid (RNA) as well. These two vary at a point where adenine of DNA pairs with thymine, but adenine of RNA pairs with uracil.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Consider the following DNA sequence:CATGTGTAGTCTAAAa. Write the sequence of the DNA strand that would be repli-cated from this one.b. Write the sequence of the RNA molecule that would betranscribed from the DNA strand.c. State how many codons the sequence specifies.d. State how many amino acids the sequence specifies
Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA
a. predict the compliment strand of dna (coding strand)
b. predict the transcribed product of the coding strand (mRNA transcript)
c. given the genetic code table, predict the amino acid sequence of the transcript
d. predict the amino acid sequence if the A underlined became deleted
Which statement is true of the translocation phase of elongation during protein synthesis?
a.
The empty tRNA moves to the A site of the ribosomal complex.
b.
The empty tRNA moves to the T site of the ribosomal complex.
c.
The dipeptide moves from the A site to the P site of the ribosomal complex.
d.
The dipeptide moves from the P site to the A site of the ribosomal complex.
Chapter 13 Solutions
Biology: Life on Earth Plus Mastering Biology with Pearson eText -- Access Card Package (11th Edition)
Ch. 13 - 1. The molecule that carries the genetic...Ch. 13 - 2. Which of the following is not true of...Ch. 13 - 3. A stop codon
a. signals the end of protein...Ch. 13 - Prob. 4MCCh. 13 - Epigenetic modification of gene expression a....Ch. 13 - Prob. 1FTBCh. 13 - The three types of RNA that are essential for...Ch. 13 - 3. The genetic code uses______ (how many?) bases...Ch. 13 - The enzyme_______ synthesizes RNA from the...Ch. 13 - Prob. 5FTB
Ch. 13 - Prob. 6FTBCh. 13 - How does RNA differ from DNA?Ch. 13 - Prob. 2RQCh. 13 - Define the following terms: genetic code, codon,...Ch. 13 - 4. How is mRNA formed from a eukaryotic gene?
Ch. 13 - 5. Diagram and describe protein synthesis.
Ch. 13 - 6. Explain how complementary base pairing is...Ch. 13 - 7. Describe the principal mechanisms of regulating...Ch. 13 - Define mutation. Describe four different effects...Ch. 13 - Many years ago, some researchers reported that...Ch. 13 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Refer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends) and tRNA. Inaddition, draw in the RNA polymerase enzyme and the ribosomes,including arrows indicating the direction of movement for each.b. What are the next three amino acids to be added to polypeptide b?c. Fill in the nucleotides in the mRNA complementary to thetemplate DNA strand.d. What is the sequence of the DNA complementary to the templatestrand (as much as can be determined from the figure)?e. Does this figure show the entire polypeptide that this geneencodes? How can you tell?f. What might happen to polypeptide b after its release from theribosome?g. Does this figure depict a prokaryotic or a eukaryotic cell? How canyou tell?arrow_forwardTranslation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCUarrow_forwardUse your genetic code (codon) table to answer the next two questions: What type of mutation would result if the sequence of a gene were altered so that the sequence of the mRNA was changed from: AUGCCGUGCAGUAAC to AUGCCAUGCAGUAAC A) a silent mutation B) a nonsense mutation C) a frame-shift mutation D) a missense mutation E) a base insertion mutationarrow_forward
- . Given the following DNA strand:TACAGTGATAACCAGATTA. Write the corresponding strand that would form the other half of the DNA molecule.B. Transcribe the original DNA strand (= TACAGTGATAACCAGATT) and write the sequence of bases found in the resulting messenger RNA molecule.C. Translate your messenger RNA molecule and write the sequence of amino acids in the resulting proteinarrow_forwardA single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.arrow_forwardGive typing answer with explanation and conclusion to all parts The pairing of the U1 snurp and the donor site signals what particular event? A. Identify the donor splice site. B. Identify/recognize intron. C. Keep the U6 RNA free from binding to the U1 RNA. D. Base pair with the nucleotides in the Branch site. E. De-branch the lariat and release the intron.arrow_forward
- A promoter is ______. a. a specific sequence of DNA nucleotides b. a specific sequence of RNA nucleotides c. a protein that binds to DNA d. an enzyme that synthesizes RNAarrow_forwardEnergy that drives translation is provided mainly by ______ . a. ATP c. GTP b. amino acids d. ribosomesarrow_forwardUse the table to answer: A portion of an mRNA attached to a ribosome reads: 5′ GACCAUUUUGACAAAGUUGUAGUGUGGGUAGGGUGA 3′ If a tRNA with a Phe attached is in the P site of the ribosome, an uncharged tRNA will be present in the E site that delivered which amino acid? What is the last amino acid in this polypeptide? Which amino acid will be the most frequent in the polypeptide?arrow_forward
- Which statement regarding UTRs is TRUE? a) Transcription begins at the start of the 5' UTR b) Translation begins at the start of the 5' UTR c) The 5' and 3' UTRs are spliced from the mRNA transcript d) The translation stop codon is found downstream of the 3' UTRarrow_forward(a) Write the complementary base sequence for the matching strand in the DNA section shown below:. 5’ – A T G T T A C T A G T C – 3’ (b) The following section of DNA is used to build an mRNA for a protein: 3′—AAG—CTT—CTC—5′. What is the corresponding mRNA sequence?arrow_forwardSelect the best answer or answers from the choices given: If DNA has a sequence of AAA, then a segment of mRNA synthesized on it will have a sequence of (a) TTT, (b) UUU, (c) GGG, (d) CCC.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY