PRESCOTT'S MICROBIO W/PROCTORIO
11th Edition
ISBN: 9781264731060
Author: WILLEY
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 13.7, Problem 3MI
MICRO INQUIRY
Why would it be impossible for fMet-tRNA to initiate peptide bond formation with another amino acid? (Hint: Examine figure 13.40 closely.)
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
m-RNA analysis
How How to protect the messenger RNA from lysis by proteases?
Need help:, The rRNAs are isolated from the large subunit of a bacterial ribosome and separated by density
gradient centrifugation. Draw the resulting density gradient and label the bands observed. Which rRNA is longest?
Only answer please, no need to explain… Thank you for your time.
i: Modification of the 5 prime ends of eukaryotic mRNA is called?
a) Capping b) Polyadenylation c) Splicing d) Transcription
ii: Genetic Code is?
a) The sequence of Nitrogenous Bases in mRNA that codes for a protein
b) Is a Triplet Code c) is Non-Overlapping d) All of these
iii. The process of formation of RNA is known as
a) Replication b) DNA repair c) Translation d) Transcription
iv. Which of the following statement is NOT true regarding transcription/RNA synthesis?
a) RNA synthesis occurs in the nucleus
b) Unlike DNA synthesis, the only selective sequence of DNA is transcribed to RNA
c) RNA synthesis requires a short stretch of RNA primers
d) DNA sequences, specific proteins, and small RNAs regulate RNA synthesis
Chapter 13 Solutions
PRESCOTT'S MICROBIO W/PROCTORIO
Ch. 13.1 - MICRO INQUIRY Based on what we now know about...Ch. 13.1 - Prob. 2MICh. 13.1 - Retrieve, Infer, Apply 1. Briefly summarize the...Ch. 13.1 - Retrieve, Infer, Apply 2. Explain how protein was...Ch. 13.2 - MICRO INQUIRY To which carbon of ribose...Ch. 13.2 - MICRO INQUIRY How many H bonds are there between...Ch. 13.2 - Prob. 3MICh. 13.2 - Prob. 1CCCh. 13.2 - Retrieve, Infer, Apply What does it mean to say...Ch. 13.2 - Retrieve, Infer, Apply Amino acids are described...
Ch. 13.3 - MICRO INQUIRY What provides the energy to fuel...Ch. 13.3 - MICRO INQUIRY What is the difference between...Ch. 13.3 - MICRO INQUIRY Why cant DNA polymerase I perform...Ch. 13.3 - Retrieve, Infer, Apply How many replicons do...Ch. 13.3 - Prob. 2CCCh. 13.3 - Retrieve, Infer, Apply Describe the nature and...Ch. 13.3 - Retrieve, Infer, Apply Outline the steps Involved...Ch. 13.3 - Retrieve, Infer, Apply What is the end replication...Ch. 13.4 - Why is the nontemplate strand called the sense...Ch. 13.4 - Retrieve, Infer, Apply The coding region of a gene...Ch. 13.4 - Which strand of a gene has sequences that...Ch. 13.4 - Briefly discuss the general organization of tRNA...Ch. 13.5 - MICRO INQUIRY Are the -35 and -10 regions...Ch. 13.5 - Retrieve, Infer, Apply Outline the transcription...Ch. 13.5 - Retrieve, Infer, Apply What is a polycistronic...Ch. 13.5 - Retrieve, Infer, Apply What is a consensus...Ch. 13.5 - Tabulate the similarities and differences between...Ch. 13.6 - Prob. 1MICh. 13.6 - What is the difference between a codon and an...Ch. 13.6 - Prob. 2CCCh. 13.6 - Retrieve, Infer, Apply What is meant by code...Ch. 13.6 - Retrieve, Infer, Apply Is the genetic code truly...Ch. 13.7 - MICRO INQUIRY Why is simultaneous transcription...Ch. 13.7 - MICRO INQUIRY What would be the outcome if an...Ch. 13.7 - MICRO INQUIRY Why would it be impossible for...Ch. 13.7 - MICRO INQUIRY What provides the energy to fuel...Ch. 13.7 - Retrieve, Infer, Apply In which direction are...Ch. 13.7 - Retrieve, Infer, Apply Briefly describe the...Ch. 13.7 - Retrieve, Infer, Apply What are the translational...Ch. 13.7 - Prob. 4CCCh. 13.7 - Retrieve, Infer, Apply How many ATP and GTP...Ch. 13.8 - Prob. 1CCCh. 13.8 - Prob. 2CCCh. 13.8 - Retrieve, Infer, Apply Give the major...Ch. 13.8 - Prob. 4CCCh. 13 - Prob. 1RCCh. 13 - Prob. 2RCCh. 13 - Prob. 3RCCh. 13 - Prob. 4RCCh. 13 - Prob. 5RCCh. 13 - Streptomyces coelicolor has a linear chromosome....Ch. 13 - You have isolated several E. coli mutants: Mutant...Ch. 13 - Prob. 3ALCh. 13 - Prob. 4AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Give typed full explanation Given the following sequence of RNA, propose the potential hairpin structure for this RNA. Indicate base pairing with a dotted line. 5’ -AGGACCCUUCGGGGUUCU-3’arrow_forwardRecall from the central dogma that DNA codes for mRNA, which then codes for protein. Also recall that directionality matters! DNA 3' TAC - CTA -AAT - TGC - TCG-ATT 5' mRNA 5' ???- ???- ???- ???- ???- ??? 3' protein ? ? ? ? ? (A) Indicate whether the DNA sequence provided is the sense strand or the antisense strand. ? that (B) For the DNA sequence given above, write out the mRNA sequence that results. (C) Now write the amino acid sequence that results from the mRNA sequence you wrote in part (B). Use the three-letter abbreviations for the amino acids. (D) What happens if the A that is bolded and underlined in the given DNA sequence is mutated (changed) to a C? How is the protein affected? This can be answered in a few words, but be specific! (E) Now let's pretend for a moment that the protein being affected is ATP-ADP translocase. What, if anything, would happen to the citric acid cycle? This should be answered in a few words/one sentence max.arrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forward
- Yes or no? Is sequence of riboprobe identical to the mrna produced by gene in situ hybridization? does column of purification in DNA allow it to flow while other molecules are trapped ?arrow_forwardtopic: translation how is the growing polypeptide released from the ribosomal assembly?arrow_forwardAGUC 24. Use the table below to answer the following question. The template strand of a gene contains this sequence: 3'-TAC TAG GCT AGT TGA-5'. A mutation occurs due to exposure to a chemical mutagen that changes the gene sequence to 3'-TAC TAG ACT AGT TGA-5'. How does this mutation affect the resulting amino acid sequence? (LS3-2) * Second mRNA base A UCU UGU Cys UGC UUU UAU Tyr UAC Phe UUC U UCC Ser UCA Phe Gly (G) Leu Glu (F) (L) UUA UAA Stop UGA Stop A Ser Asp (E) (D) Leu (S) UCG UUG UAG Stop UGG Trp Tyr (Y) Ala CUU CCU CAU CGU U (A) His C G U A CỤC Leu CUA CC Pro CCA CAC CGC Arg CGA Cys (C) G A Val CAA (V) Gln G Trp (W) CUG CCG CAG CGG G Arg (R) G А С A Leu AUU ACU AAU AGU (L) Asn Ser Ser (S) AUC Ile ACC Thr ACA AAC AGC C/ Lys (K) UGA AUA Pro AAA Lys AAG AGA Arg AGG Asn (N) (P) AUG Met or start ACG His Thr (T) Gin (H) (Q) GUU GCU GAU GGU lle Asp Arg (R) (1) GUC Val GUA GCC GAC GGC Ala GCA Gly GGA GAA Glu GAG GUG GCG GGG The mutation changes a single amino acid to another amino…arrow_forward
- You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosomearrow_forwardINSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: Amino acyl tRNA synthase is the enzyme responsible for joining amino acid together STAMENT 2: Nucleus is the part of the cell where translation takes place ANSWER: STAMENT 1: DNA sequences where RNA polymerase binds initially is called promoter sequences STAMENT 2: UV light causes adenine to dimerize ANSWER: STAMENT 1: Guanosine is the name of the compound formed when guanine is bonded to ribose STAMENT 2: DNA pairing is the term that refers to the process when two complementary and single stranded DNA combine ANSWER:arrow_forwardMRNA- based therapeutics The following questions: Which research group has initially developed the technology? What was the purpose behind the invention of the technology? What type of questions could be answered with the technology? What are the applications of the technology? Are there any clinical trials associated with the method? What is the mechanism of action for the technology?arrow_forward
- In the absence of cladosporin, explain the initiation steps in the synthesis of lysyl-tRNA synthetase enzyme or protein in the bacterial cell, with the involvement of all initiation factors, each site in the ribosome, any important conserved sequence, subunits of ribosomes, initiation codon, charged tRNA containing what amino acid, whether it requires ATP or GTParrow_forwardWorksheet (Nucleic Acid) Name: Section: Date: This activity uses the metaphor of decoding a secret message for the Protein Synthesis. PARTIALLY SOLVED MESSAGE GIVEN: DNA code message --> GAA TAG AAA CTT ACT TAG AGC ATT CCT GCC CTT CGA TGC ATC SOLUTION (steps 1-4) 1. MRNA (built to match the DNA message, letter for letter---- → CUU AUC UUU GAA UGA AUC UCG 2. TRNA (determined by matching letters (bases) with those in mRNA)--- GAA UAG AAA CUU ACU UAG BBEE B 3. Amino acids carried by L I P G I each tRNA (according to dictionary, below)-----------> e S h e 4. Symbols of amino acids:--→ L F Earrow_forwardGTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY