Genetics: From Genes To Genomes (6th International Edition)
6th Edition
ISBN: 9781260041217
Author: Leland Hartwell Dr., ? Michael L. Goldberg Professor Dr., ? Janice Fischer, ? Leroy Hood Dr.
Publisher: Mcgraw-Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 14, Problem 16P
In E. coli, the genes purC and pyrB are located halfway around the chromosome from each other. These genes are never cotransformed. Why not?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
"In E. coli, where the replication fork travels at 500 nucleotide pairs per second, the DNA ahead of the fork-in the absence of topoisomerase-would have to rotate at nearly 3000 revolutions per minute" is true or false.
F ′strains in E. coli are derived from Hfr strains. In some cases, these F ′strains show a high rate of integration back into the bacterial chromosome of a second strain. Furthermore, the site of integration is often the site occupied by the sex factor in the original Hfr strain (before production of the F ′strains). Explain these results.
Supercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more compact structure with enhanced physical stability. Describe the enzymes that control the number of supercoils present in the E. coli chromosome. How much would you have to reduce the linking number to increase the number of supercoils by five?
Chapter 14 Solutions
Genetics: From Genes To Genomes (6th International Edition)
Ch. 14 - Choose the phrase from the right column that best...Ch. 14 - The unicellular, rod-shaped bacterium E. coli is 2...Ch. 14 - Now that the sequence of the entire E. coli K12...Ch. 14 - Bacterial genomes such as that of E. coli...Ch. 14 - List at least three features of eukaryotic genomes...Ch. 14 - Describe a mechanism by which a gene could move...Ch. 14 - High salt concentrations tend to cause protein...Ch. 14 - Recently, scientists tested the possibility that...Ch. 14 - A recent metagenomic study analyzed the...Ch. 14 - Linezolid is a new type of antibiotic that...
Ch. 14 - A liquid culture of E. coli at a concentration of...Ch. 14 - Pick out the medium i, ii, iii, or iv onto which...Ch. 14 - This problem concerns Fig. 14.14, which...Ch. 14 - In two isolates one is resistant to ampicillin,...Ch. 14 - E. coli cells usually have only one copy of the F...Ch. 14 - In E. coli, the genes purC and pyrB are located...Ch. 14 - DNA sequencing of the entire H. influenzae genome...Ch. 14 - Genes encoding toxins are often located on...Ch. 14 - a. You want to perform an interrupted-mating...Ch. 14 - In Problem 19, do you think that most of the...Ch. 14 - One issue with interrupted-mating experiments such...Ch. 14 - Prob. 22PCh. 14 - Starting with an F- strain that was prototrophic...Ch. 14 - You can carry out matings between an Hfr and F...Ch. 14 - Genome sequences show that some pathogenic...Ch. 14 - Generalized and specialized transduction both...Ch. 14 - This problem highlights some useful variations of...Ch. 14 - A researcher has a Trp auxotrophic strain of E....Ch. 14 - Streptococcus parasanguis is a bacterial species...Ch. 14 - The sequence at one end of one strand of the...Ch. 14 - Scientists who study amino acid biosynthesis...Ch. 14 - Suppose that you could obtain radioactively...Ch. 14 - Prob. 34PCh. 14 - Some scientists are trying to engineer...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Why do adult human cells (other than germ cells and stem cells) NOT express the enzyme telomerase? In other words what benefit does not having telomerase provide to these cells?arrow_forwardWhether the statement "In E. coli, where the replication fork travels at 500 nucleotide pairs per second, the DNA ahead of the fork-in the absence of topoisomerase-would have to rotate at nearly 3000 revolutions per minute" is true or false.arrow_forwardWhat distinguishes topoisomerase type I from topoisomerase type II (“gyrase”) in E. coli bacteria? Both types of topoisomerases participate in the formation of nucleosomes. Topoisomerase type I cleaves one strand of a DNA duplex to remove DNA supercoils, and topoisomerase type II cleaves both strands of the DNA duplex when introducing negative supercoils into the molecule. Topoisomerase type I works to replicate DNA and topoisomerase type II works to transcribe RNA. Topoisomerase type I works on double-stranded DNA, and topoisomerase type II ("gyrase") works on single-stranded DNA. Topoisomerase type I adds negative DNA supercoils, and topoisomerase type II removes them.arrow_forward
- The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forwarda) Under normal conditions E. coli produces three DNA polymerases. State their functional similarities and differences. b) List the other proteins and enzymes involved in DNA replication in E.coli and give their functions.arrow_forwardIf the recipient cell did not already have a lys− gene, could the lys+ DNA become incorporated into the bacterial chromosome? Explain.arrow_forward
- Considering that prokaryote genomes do not have large introns, how is it possible to move a eukaryotic gene into a transformed bacterium, since they lack a spliceosome?arrow_forwardWhy can’t a linear duplex DNA, such as that of bacteriophage T7, be fully replicated by just E. coli-encoded proteins?arrow_forwardDirect repair of pyrimidine dimer formation in E. Coli can be accomplished by nucleotide excision. true or false?arrow_forward
- The E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition sequence for the trp repressor would be expected to occur in the E. coli chromosome? (b) Explain why it is advantageous for the trp repressor to be a dimer that recognizes two adjacent 6-bp sequences.arrow_forwardPredict whether loss of the following E. coli genes would be lethal or not: (a) dnaB (which encodes DnaB), (b) polA (which encodes Pol I), (c) ssb, (d) recA.arrow_forwardIn E. coli, four Hfr strains donate the following markers,shown in the order donated:Strain 1: M Z X W CStrain 2: L A N C WStrain 3: A L B R UStrain 4: Z M U R BAll these Hfr strains are derived from the same F+ strain.What is the order of these markers on the circularchromosome of the original F+?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license