Concept explainers
Linezolid is a new type of antibiotic that inhibits protein synthesis in several bacterial species by binding to the
50S subunit of the ribosome and inhibiting its ability to participate in the formation of translational initiation complexes. Physicians are particularly interested in this antibiotic for treating pneumonia caused by penicillin resistant Streptococcus pneumoniae (also called pneumococci). To explore the mechanisms by which pneumococci can develop resistance to linezolid, you first want to identify linezolid-resistant strains. Next, using one of these strains as starting material, you want to identify derivatives of these mutants that are no longer tolerant of linezolid.
a. | Outline the techniques you would use to identify linezolid-resistant mutant pneumococci and linezolid-sensitive derivatives of these mutants. In each case, would your techniques involve direct selection, screening, replica plating, treating with mutagens, or testing for a visible phenotype? |
b. | Suggest possible mutations that could be responsible for the two kinds of What types of events in the bacterial cells would be altered by the mutations? Do you think that these mutations would be loss-of-function or gain-of-function? Explain. |
Trending nowThis is a popular solution!
Chapter 14 Solutions
Genetics: From Genes To Genomes (6th International Edition)
- You are interested in the activity and regulation of a protease made by the Gram-positive bacterium Geobacillus stearothermophilus. What would be the purpose of constructing each of the following: a His-tagged protease, a transcriptional GFP fusion to the protease gene, and a translational GFP fusion to the protease gene?arrow_forwardLinezolid is a new type of antibiotic that inhibits protein synthesis in several bacterial species by bindingto the 50S subunit of the ribosome and inhibiting its ability to participate in the formation of translationalinitiation complexes. Physicians are particularlyinterested in this antibiotic for treating pneumoniacaused by penicillin-resistant Streptococcus pneumoniae (also called pneumococci). To explore themechanisms by which pneumococci can developresistance to linezolid, you first want to identifylinezolid-resistant strains. Next, using one of thesestrains as starting material, you want to identifyderivatives of these mutants that are no longertolerant of linezolid.a. Outline the techniques you would use to identifylinezolid-resistant mutant pneumococci andlinezolid-sensitive derivatives of these mutants.In each case, would your techniques involve directselection, screening, replica plating, treating withmutagens, or testing for a visible phenotype?b. Suggest possible…arrow_forwardIf the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individualarrow_forward
- In the treatment of acquired immunodeficiency syndrome (AIDS), a possible mode of therapy is to inhibit the reverse transcriptase (RT) of the human immunodeficiency virus (HIV), whcih is required for the retrovirus to be propogated by RNA-directed DNA synthesis. In the figure below, one of the substrates for RT is thymidine; and two drugs, AZT and HBY097 are known to inhibit HIV RT> (a) Thymidine; (b) AZT; (c) HBY097 Look at the structures and predict the type of inhibition (i.e. competitive or non-competitive) likely to be shown by each drug. By using knowledge on enzyme, plan an experiment that would enable you to confirm the type of inhibition by investigating enzyme kinetics and explain how you would interpret the results.Remarks: Not more than 250 words.arrow_forwardAzidothymidine is a Thymidine analog used to inhibit viral reverse transcriptase. Explain the application of this nucleoside analog as an antiviral drug and how it affects reverse transcription and therefore block the ability of the virus to hijack the host cellarrow_forwardA number of mutations affect the expression of the lac operon in E. coli. The genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene with normal function and "-" indicates a loss-of-function allele.) Please predict which of the following strains would have the highest beta-galactosidase enzyme activity, when grown in the lactose medium. O CAP+ r* p* o* z O CAP* I P* o* z* O CAP* r* P O* z* O CAP I P* O z*arrow_forward
- The lac operon contains the genes that the bacterium needs to be able to use lactose as a carbon source. What would happen to the regulation of the Lac operon if: a) a mutation has occurred in the Lac Z gene which results in the formation of no functional β-galactosidase b) a mutation has occurred in the CAP protein so that cAMP cannot bindarrow_forwardUse the blanks on the left hand side to put the following statements in order (use numbers or letters to designate the order). All of the statements refer to the diauxic (sequential) growth of a bacterium on the carbon substrates glucose and lactose (see textbook Fig 4.11 on diauxic growth). Remember, the lac operon contains the genes necessary for the lactose catabolism. The glucose substrate is completely consumed, at which time the repressor protein on the lac operon unbinds from the DNA molecule. The lactose substrate is catabolized by the active B-galactosidase enzyme. Glucose, as the preferred carbon substrate, is first consumed by catabolic enzymes that are constitutive (always present). After completion of translation, the B-galactosidase enzyme undergoes folding to form into an active enzyme that can breakdown lactose into its constituent monosaccharides. The messenger RNA code from the lac operon is translated by ribosomal RNAS to form lac-related enzymes, such as…arrow_forwardNeurospora crassa can synthesize the amino acid arginine from a precursor as follows: precursor ornithine citrulline arginine George Beadle and Edward Tatum identified various mutants (arg mutants) unable to synthesize arginine from this precursor. One such class (Class I) could synthesize arginine if either ornithine or citrulline was supplied. A second mutant class (Class II) could synthesize arginine if citrulline was added, but not if ornithine was added. A third class (Class III) could not synthesize arginine from either ornithine or citrulline. Which class or classes of arg mutants will grow on complete media?arrow_forward
- Why would a mutation in a somatic cell of a multicellular organism escape detection?arrow_forwardwhat is the nature and likely location(s) of a mutant that would, 1)allow constitutive expression of the lac gene? 2)prevent the cell from responding to lactose ( genes are not induced when exposed to lactose)? 3) not allow the cell to utilize lactose even when the genes are inducedarrow_forwardThe following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education