Introduction: Mechanism of expression of genes is regulated by various types of gene products. These genes can be switched on or off during the course of gene expression. Some genes express continuously, while some express only at the time of need of their expression.
Answer to Problem 1TY
Correct answer: Genes that are expressed at all time constantly are called constitutive genes. Hence, the correct answer is option d.
Explanation of Solution
Reason for correct answer:
Constitutive genes are those genes which express at constant levels at all time. Products of such genes regulate processes associated with biochemical activities of cells.
Option d. is given as “constitutive”.
Constitutive genes are special genes that are expressed at constant levels at every time for effective regulation of gene expression process. Hence, the correct answer is option d.
Reasons for incorrect answer:
Option a. is given as, “inducible”.
Inducible genes are genes whose activity is controlled by the external factors. These genes are not expressed all the times in the cell. Hence, option a. is incorrect.
Option b. is given as, “repressible”.
Repressible genes are genes whose activity is affected at the time of higher concentration of products. High product concentration represses these genes to maintain constant level of products in the cell. These genes are not expressed at all time at constant levels in the cell. Hence, option b. is incorrect.
Option c. is given as, “positive”.
No positive genes are associated with the gene regulation process. Hence, option c. is incorrect.
Option e. is given as, “negative”.
No negative genes are associated with the gene regulation and expression mechanisms. Hence, option e. is incorrect.
Hence, the options a., b. ,c., and e. are incorrect.
Constitutive genes express continuously at constant levels in the cell and perform a vital role in the regulation of gene expression.
Want to see more full solutions like this?
Chapter 14 Solutions
BIOLOGY
- Epigenetic changes in gene regulation are caused by _ _ _ _ _ _ _ a. missing nucleotides or chromosomes b. modifications to histones and the DNA, but not the nucleotide sequence itself c. mutations of the nucleotide sequencearrow_forwardPositive regulators are called: A. Repressors B. Activators C. Enhancers D. None of the abovearrow_forwardWhich of the following is NOT a mechanism of control of gene expression Group of answer choices a. Co-dominance b. mRNA transport c. DNA Methylation d. Control of translation e. Control of transcriptionarrow_forward
- Which of the following statements did Yamanaka rely on to produce induced pluripotent stem cells (IPSC)? [Note: This is higher level thinking. All statements on their own are correct and may be related to IPSC production but there is only one statement that played an essential role in the production of IPSC) O A. A proportion of embryonic stem cells can differentiate into adult stem cells. B. Only a small proportion of genes are expressed in each celI. C. Telomerase is active in pluripotent stem cells. D. All genes retain the potential to be expressed.arrow_forwardWhich of the following gene expression regulatory mechanisms saves the most energy but takes the longest to fully express the genes once signaled? a. transcriptional regulation b. post-transcriptional regulation c. post-translational regulation d. translational regulationarrow_forwardE. coli has five genes that code for enzymes that make tryptophan. These genes are regulated by a single promoter and transcribed as one long gene. The presence of tryptophan shut down the production of tryptophan by the cell by binding to the repressor. This changes the repressors shape allowing it to bind to DNA operator, blocking RNA polymerase and cutting off the production of tryptophan. a. Describe what woud happen to the operon if some of the cells had a mutation on the repressor, not allowing it to bind with tryptophan. The repressor is described as an allosteric protein. What does this mean? b. Does the tryptophan model demonstrate an inducible or repressible operon? What is your evidence? *arrow_forward
- Which of the following is not an example of constitutively expressed gene? a. genes for cell division and growth b. genes involved in DNA repair c. genes for cellular respiration d. genes that function in ATP synthesisarrow_forwardIn the table below the product of gene R binds to the promoter of gene A. What happens in (b)? a. Mutant protein A produced b. No Protein A produced c. No protein C produced d. No protein R producedarrow_forwardHow would each of the following types of mutations affect proteinfunction or the amount of functional protein that is expressed froma gene?A. Nonsense mutationB. Missense mutationC. Up promoter mutationD. Mutation that affects splicingarrow_forward
- Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repairarrow_forwardDuring attenuation, when tryptophan levels are high, the ________ stem-loop forms and transcription _________ the trpL gene. a. 1–2, ends just past b. 3–4, ends just past c. 1–2, continues beyond d. 3–4, continues beyondarrow_forwardIntitial analysis of a human colon cancer tumor indicates mutations/defects in APC, B-Raf and p53. Which of the genes below is also most likely mutated in this tumor (select one)? A. Beta-catenin B. K-RAS C. SMAD4 D. MDM2 E. p14 ARFarrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education