![Concepts of Genetics Plus Mastering Genetics with Pearson eText -- Access Card Package (12th Edition) (What's New in Genetics)](https://www.bartleby.com/isbn_cover_images/9780134811390/9780134811390_largeCoverImage.gif)
Concept explainers
The flow of genetic information from DNA to protein is mediated by messenger RNA. If you introduce short DNA strands (called antisense oligonucleotides) that are complementary to mRNAs, hydrogen bonding may occur and “label” the DNA/RNA hybrid for ribonuclease-H degradation of the RNA. One study [Lloyd et al. (2001). Nud. Acids Res. 29:3664–3673] compared the effect of different-length antisense oligonucleotides upon ribonuclease-H–mediated degradation of tumor necrosis factor (TNFα) mRNA. TNFα exhibits antitumor and pro-inflammatory activities. The following graph indicates the efficacy of various-sized antisense oligonucleotides in causing ribonuclease-H cleavage.
- (a) Describe how antisense oligonucleotides interrupt the flow of genetic information in a cell.
- (b) What general conclusion can be drawn from the graph?
- (c) What factors other than oligonucleotide length are likely to influence antisense efficacy in vivo?
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 14 Solutions
Concepts of Genetics Plus Mastering Genetics with Pearson eText -- Access Card Package (12th Edition) (What's New in Genetics)
- 5. a) Describe, using a diagram or point form notes, what is happening during transcription and translation of protein synthesis. Indicate where these events take place in the cell. b) An error occurs in the transcription of the original master strand of DNA. At the very first base pair, a guanine is substituted for cytosine. State the possible effects on the polypeptide and its functions.arrow_forwardDescribe the steps necessary to synthesize mRNA fromeach of the following: double-stranded DNA, singlestranded (1)DNA, single-stranded (2)DNA, singlestranded (1)RNA, and single-stranded (2)RNA.arrow_forwardDescribe the mode of action of ribonuclease enzyme.arrow_forward
- A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.arrow_forwardAn RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP and GTP. When this RNA is used in an in vitro translation system, all of the following amino acids could be incorporated into a newly made polypeptide, except: glycine (Gly) histidine (His) proline (pro) alanine (Ala) arginine (Arg)arrow_forwardA segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)arrow_forward
- Below is a template strand of DNA. Assume the transcription start site is outside of this sequence so that the whole sequence is transcribed. After the mRNA is made, what amino acid sequence would be translated from this sequence? Translation begins at the first start codon of the mRNA. DNA template strand: 5’ ...ACTGATGCCCATGGC... 3’ a)Met-Pro-Met b)Ala-Met-Gly-Ile-Ser c)Thr-Asp-Ala-His-Gly d)Met-Gly-Ile-Serarrow_forwardGiven the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.arrow_forwardIn eukaryotic cells, the length of the transcribed RNA is almost equal to the corresponding DNA strand. True or false?arrow_forward
- The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA as a template strand for transcription, you are required to synthesize a new RNA strand. A) Show the codons that will be present on the RNA strand. B) Using the universal genetic code, provide the amino acids on the protein that will be translated from the RNA strand. 3’ TAC ATG GTT GTG CTA ATT 5’arrow_forwardConsider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?arrow_forwardTRUE OR FALSE a) Primary amines and keto groups of the nitrogen bases are involved in base-pairing in double stranded DNA. b) The unique stem-loop structures of the transfer RNA helps the RNA perform its function of joining ribosomal proteins to form the sites for protein synthesis.arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)