![Concepts of Genetics Plus Mastering Genetics with Pearson eText -- Access Card Package (12th Edition) (What's New in Genetics)](https://www.bartleby.com/isbn_cover_images/9780134811390/9780134811390_largeCoverImage.gif)
Concepts of Genetics Plus Mastering Genetics with Pearson eText -- Access Card Package (12th Edition) (What's New in Genetics)
12th Edition
ISBN: 9780134811390
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 14, Problem 6PDQ
The α chain of eukaryotic hemoglobin is composed of 141 amino acids. What is the minimum number of
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
The a chain of eukaryotic hemoglobin is composed of 141 amino acids. What is the minimum number of nucleotides in an mRNA coding for this polypeptide chain?
A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this glutamic acid has been replaced by a valine. List all the possible mRNA codons that could be present for each type of hemoglobin. Can a single base change result in a change from Glu to Val in hemoglobin?
Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.
Chapter 14 Solutions
Concepts of Genetics Plus Mastering Genetics with Pearson eText -- Access Card Package (12th Edition) (What's New in Genetics)
Ch. 14 - Prob. 1NSTCh. 14 - A series of mutations in the bacterium Salmonella...Ch. 14 - HbS results from the substitution of valine for...Ch. 14 - Given that a faulty ribosomal protein is the...Ch. 14 - A couple with a child affected with DBA undergoes...Ch. 14 - Prob. 3CSCh. 14 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 14 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 14 - Contrast the roles of tRNA and mRNA during...Ch. 14 - Francis Crick proposed the adaptor hypothesis for...
Ch. 14 - During translation, what molecule bears the codon?...Ch. 14 - The chain of eukaryotic hemoglobin is composed of...Ch. 14 - Assuming that each nucleotide in an mRNA is 0.34...Ch. 14 - Summarize the steps involved in charging tRNAs...Ch. 14 - To carry out its role, each transfer RNA requires...Ch. 14 - What are isoaccepting tRNAs? Assuming that there...Ch. 14 - When a codon in an mRNA with the sequence 5-UAA-3...Ch. 14 - Discuss the potential difficulties of designing a...Ch. 14 - Prob. 13PDQCh. 14 - Prob. 14PDQCh. 14 - The synthesis of flower pigments is known to be...Ch. 14 - The study of biochemical mutants in organisms such...Ch. 14 - Explain why the one-gene: one-enzyme concept is...Ch. 14 - Why is an alteration of electrophoretic mobility...Ch. 14 - Prob. 19PDQCh. 14 - Prob. 20PDQCh. 14 - Prob. 21PDQCh. 14 - Prob. 22PDQCh. 14 - Several amino acid substitutions in the and ...Ch. 14 - Define and compare the four levels of protein...Ch. 14 - What are the two common types of protein secondary...Ch. 14 - How do covalent disulfide bonds, hydrogen bonds...Ch. 14 - Prob. 27PDQCh. 14 - List three different types of posttranslational...Ch. 14 - Prob. 29PDQCh. 14 - How does an enzyme function? Why are enzymes...Ch. 14 - Prob. 31PDQCh. 14 - Three independently assorting genes (A, B, and C)...Ch. 14 - How would the results vary in cross (a) of Problem...Ch. 14 - Deep in a previously unexplored South American...Ch. 14 - Many antibiotics are effective as drugs to fight...Ch. 14 - The flow of genetic information from DNA to...Ch. 14 - Prob. 37ESP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?arrow_forwardB) The beta chain of eukaryotic protein is made up of 141 amino acids. What is the minimum number of nucleotides for the mRNA coding for this polypeptide?arrow_forwardWhat is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UAA -GUU-3’?arrow_forward
- Three E. coli tRNA molecules with the anticodon sequences CGG, OGG , and UGG are charged with the same amino acid. What is the amino acid ?arrow_forward(b) Hemoglobin is made of B-globin subunits. The first few mRNA nucleotides for B- globin are given by: (1) (iii) (iv) Write down the DNA sequence that has led to this mRNA and indicate the sense and non-sense strands and the polarity. CE Derive the polypeptide for the sequence using the table of the genetic code (Table Q1 below) and indicate the polarity of the polypeptide chain. First Position (5' end) U A single point mutation in mRNA sequence can cause sickle cell anemia by changing the amino acid Glu to Val. For the given mRNA, indicate the point mutations for the first Glu in the polypeptide sequence that can cause this disease. 5'-AUGGUCCACCUGACUCCUGAGGAGAAG...UGA-3' C The polypeptide of B-globin contains the amino acid Leu. Write down all the anticodons of the tRNA molecules that can potentially code for Val. Indicate the polarity of the anti-codon. A G Table 1. The Codons of the Genetic Code Second Position U Phe Phe Leu Leu Leu Leu Leu Leu Ile Ile Ile Met-Start Val Val Val…arrow_forwardA eukaryotic cell carrying out transcription and RNA processing is incubated with 32P-labeled ATP. Where will the radioactive isotope appear in mature mRNA if the ATP is labeled at the (a) α position, (b) β position, and (c) γ position?arrow_forward
- Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?arrow_forwardThe following RNA sequence represents a small messenger which can be translated in a prokaryotic cell: 5'-ACGAAUGCACAGUAAAACUGGCUAGCGUAGGCUGA-3 Assume that the messenger RNA is translated in the cell, using the correct machinery and signals required for accurate protein synthesis. Using this RNA sequence and the Genetic Code Dictionary (see your textbook for the dictionary), solve the following problems A. Write the sequence of a protein that would be translated from this mRNA, using the appropriate stop and start signals, and indicating the correct termini of the protein product. B. Suppose that the underlined A in the sequence is changed to a U. Write the expected protein product of this mRNA.arrow_forwardUsing the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A Garrow_forward
- What are the amino acids carried by tRNAs if their anticodons are either 5'-CAU-3' and 3'-GUC-5'?arrow_forwardIn prokaryotic protein synthesis, formylmethionine (fmet) is the first amino acid incorporated, whereas (normal) methionine is incorporated in eukaryotes. The same codon (AUG) serves both. What prevents methionine from being inserted into the beginning and formylmethionine in the interior?arrow_forwardUsing the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAUarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY